Incidental Mutation 'R7781:Coq7'
ID599241
Institutional Source Beutler Lab
Gene Symbol Coq7
Ensembl Gene ENSMUSG00000030652
Gene Namedemethyl-Q 7
Synonymsclk-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location118509659-118533356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118525888 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 171 (I171N)
Ref Sequence ENSEMBL: ENSMUSP00000095695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032887] [ENSMUST00000098090] [ENSMUST00000209146]
Predicted Effect probably damaging
Transcript: ENSMUST00000032887
AA Change: I171N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032887
Gene: ENSMUSG00000030652
AA Change: I171N

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 217 3.5e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098090
AA Change: I171N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095695
Gene: ENSMUSG00000030652
AA Change: I171N

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 210 5.9e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209146
AA Change: I171N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for null mutations in this gene are embryonic lethal during mid-gestation with aborted neurogenesis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bicdl1 T C 5: 115,661,487 E181G probably damaging Het
Bnipl C A 3: 95,244,175 W272L probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Faap100 T C 11: 120,374,263 M596V probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lamp3 A T 16: 19,699,690 S266T possibly damaging Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Olfr1252 A G 2: 89,721,535 F192S probably benign Het
Plxnb2 T A 15: 89,157,022 M1774L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tmem231 C T 8: 111,918,290 probably null Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zcchc2 T C 1: 106,004,165 Y366H probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Coq7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Coq7 APN 7 118525304 missense probably damaging 0.98
R0309:Coq7 UTSW 7 118529717 missense possibly damaging 0.92
R0628:Coq7 UTSW 7 118529644 missense probably damaging 1.00
R1459:Coq7 UTSW 7 118510037 missense unknown
R1535:Coq7 UTSW 7 118529674 missense possibly damaging 0.48
R1612:Coq7 UTSW 7 118509911 missense unknown
R2519:Coq7 UTSW 7 118510148 missense unknown
R4095:Coq7 UTSW 7 118527478 critical splice acceptor site probably null
R4516:Coq7 UTSW 7 118509907 missense unknown
R4972:Coq7 UTSW 7 118510117 missense unknown
R5183:Coq7 UTSW 7 118528267 intron probably benign
R5579:Coq7 UTSW 7 118517335 missense unknown
R5619:Coq7 UTSW 7 118527486 splice site probably benign
R5789:Coq7 UTSW 7 118529706 missense possibly damaging 0.50
R6530:Coq7 UTSW 7 118525335 missense probably benign 0.01
R6911:Coq7 UTSW 7 118510162 missense unknown
R7212:Coq7 UTSW 7 118510048 missense unknown
R7248:Coq7 UTSW 7 118529674 missense probably benign 0.42
R7361:Coq7 UTSW 7 118529575 missense probably benign 0.15
R8039:Coq7 UTSW 7 118533246 missense possibly damaging 0.93
R8796:Coq7 UTSW 7 118527417 missense probably damaging 0.96
RF001:Coq7 UTSW 7 118533182 missense probably benign 0.05
Z1177:Coq7 UTSW 7 118510149 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGACCAAGGCTGTGCTTG -3'
(R):5'- AAGTCTCATTAGAGCCACAGC -3'

Sequencing Primer
(F):5'- GTGCTTTCTGTCAAGTACCCG -3'
(R):5'- CACAGCTATGGGTTACTCTTGCAAG -3'
Posted On2019-11-26