Incidental Mutation 'R7781:Tmem231'
ID599245
Institutional Source Beutler Lab
Gene Symbol Tmem231
Ensembl Gene ENSMUSG00000031951
Gene Nametransmembrane protein 231
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location111912011-111933881 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 111918290 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034429] [ENSMUST00000211866]
Predicted Effect probably null
Transcript: ENSMUST00000034429
SMART Domains Protein: ENSMUSP00000034429
Gene: ENSMUSG00000031951

DomainStartEndE-ValueType
Pfam:TM231 1 301 5.8e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211866
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete lethality throughout fetal growth and development, defective patterning of the ventral spinal cord, a striking loss in cilia, severe vascular defects, polydactyly, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bicdl1 T C 5: 115,661,487 E181G probably damaging Het
Bnipl C A 3: 95,244,175 W272L probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Coq7 A T 7: 118,525,888 I171N probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Faap100 T C 11: 120,374,263 M596V probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lamp3 A T 16: 19,699,690 S266T possibly damaging Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Olfr1252 A G 2: 89,721,535 F192S probably benign Het
Plxnb2 T A 15: 89,157,022 M1774L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zcchc2 T C 1: 106,004,165 Y366H probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Tmem231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tmem231 APN 8 111918440 splice site probably benign
IGL02800:Tmem231 APN 8 111914032 missense probably benign 0.03
R2281:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R2306:Tmem231 UTSW 8 111918871 missense probably damaging 1.00
R3615:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R3616:Tmem231 UTSW 8 111918313 missense possibly damaging 0.63
R4541:Tmem231 UTSW 8 111914592 missense probably benign 0.02
R4708:Tmem231 UTSW 8 111933786 start gained probably benign
R5522:Tmem231 UTSW 8 111918410 missense possibly damaging 0.92
R6266:Tmem231 UTSW 8 111915265 missense probably null 0.71
R6414:Tmem231 UTSW 8 111926892 intron probably benign
R6415:Tmem231 UTSW 8 111926892 intron probably benign
R6418:Tmem231 UTSW 8 111926892 intron probably benign
R6419:Tmem231 UTSW 8 111926892 intron probably benign
R6622:Tmem231 UTSW 8 111918931 missense probably damaging 1.00
R6938:Tmem231 UTSW 8 111933512 missense probably damaging 0.97
R7103:Tmem231 UTSW 8 111918885 synonymous probably null
R7221:Tmem231 UTSW 8 111933676 missense probably benign
R7305:Tmem231 UTSW 8 111915295 missense possibly damaging 0.70
R7438:Tmem231 UTSW 8 111918408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTAAGGACGTGGGCTTG -3'
(R):5'- TCAGCTGCTGACAAGTGAGTTG -3'

Sequencing Primer
(F):5'- GGGTCCAGCACTGCACATTTATG -3'
(R):5'- GGCTCTTCAGACCTGACAATG -3'
Posted On2019-11-26