Incidental Mutation 'R7781:Faap100'
ID599251
Institutional Source Beutler Lab
Gene Symbol Faap100
Ensembl Gene ENSMUSG00000025384
Gene NameFanconi anemia core complex associated protein 100
Synonyms2310003H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location120369055-120378764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120374263 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 596 (M596V)
Ref Sequence ENSEMBL: ENSMUSP00000026448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026448]
Predicted Effect probably benign
Transcript: ENSMUST00000026448
AA Change: M596V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384
AA Change: M596V

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP100 is a component of the Fanconi anemia (FA; MIM 277650) core complex and is required for core complex stability and FANCD2 (see MIM 227646) monoubiquitination (Ling et al., 2007 [PubMed 17396147]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bicdl1 T C 5: 115,661,487 E181G probably damaging Het
Bnipl C A 3: 95,244,175 W272L probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Coq7 A T 7: 118,525,888 I171N probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lamp3 A T 16: 19,699,690 S266T possibly damaging Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Olfr1252 A G 2: 89,721,535 F192S probably benign Het
Plxnb2 T A 15: 89,157,022 M1774L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tmem231 C T 8: 111,918,290 probably null Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zcchc2 T C 1: 106,004,165 Y366H probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Faap100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Faap100 APN 11 120372132 missense probably damaging 1.00
IGL02954:Faap100 APN 11 120372131 missense probably damaging 1.00
IGL02799:Faap100 UTSW 11 120370735 missense probably damaging 1.00
R0034:Faap100 UTSW 11 120372147 missense probably benign 0.34
R0207:Faap100 UTSW 11 120374365 missense probably damaging 1.00
R0432:Faap100 UTSW 11 120373876 splice site probably benign
R0570:Faap100 UTSW 11 120374288 missense possibly damaging 0.87
R0748:Faap100 UTSW 11 120372171 missense probably damaging 0.97
R0782:Faap100 UTSW 11 120376704 critical splice donor site probably null
R1218:Faap100 UTSW 11 120378340 missense probably benign 0.06
R1612:Faap100 UTSW 11 120377088 missense probably damaging 1.00
R1720:Faap100 UTSW 11 120374581 missense probably damaging 1.00
R1758:Faap100 UTSW 11 120377233 missense probably damaging 0.99
R2881:Faap100 UTSW 11 120374359 missense probably damaging 1.00
R2893:Faap100 UTSW 11 120374625 missense probably damaging 1.00
R3969:Faap100 UTSW 11 120378705 start codon destroyed probably null 1.00
R4824:Faap100 UTSW 11 120375586 splice site probably null
R4911:Faap100 UTSW 11 120372113 missense probably benign 0.37
R5152:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5155:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5327:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5328:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5386:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5480:Faap100 UTSW 11 120377113 missense probably damaging 1.00
R5541:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5629:Faap100 UTSW 11 120377011 missense probably damaging 1.00
R5911:Faap100 UTSW 11 120377132 missense possibly damaging 0.94
R6285:Faap100 UTSW 11 120376732 missense probably damaging 1.00
R6350:Faap100 UTSW 11 120374580 missense probably damaging 1.00
R6525:Faap100 UTSW 11 120378764 splice site probably null
R7046:Faap100 UTSW 11 120377374 missense possibly damaging 0.94
R7539:Faap100 UTSW 11 120377638 missense possibly damaging 0.73
R8345:Faap100 UTSW 11 120377030 missense possibly damaging 0.58
R8679:Faap100 UTSW 11 120372177 missense probably damaging 1.00
R8715:Faap100 UTSW 11 120374473 missense probably benign 0.13
R8942:Faap100 UTSW 11 120377030 missense possibly damaging 0.58
R8956:Faap100 UTSW 11 120377359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCCACAGGCTCACAGG -3'
(R):5'- CAGGGCTGGACCTTGTGTATTC -3'

Sequencing Primer
(F):5'- CAGGGCCAGGCATACAGG -3'
(R):5'- ATTCAGGTGCTGACTAGTTCC -3'
Posted On2019-11-26