Incidental Mutation 'R7781:Kcnh5'
ID 599252
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 5
Synonyms
MMRRC Submission 045837-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7781 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 74943994-75224106 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 75023455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 538 (V538F)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
AlphaFold Q920E3
Predicted Effect probably damaging
Transcript: ENSMUST00000042299
AA Change: V538F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: V538F

DomainStartEndE-ValueType
PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,682,706 (GRCm39) P23S unknown Het
Abcc6 C T 7: 45,655,030 (GRCm39) R487Q probably damaging Het
Abl1 A T 2: 31,680,709 (GRCm39) T334S probably damaging Het
Adam6b T C 12: 113,454,962 (GRCm39) F593S probably damaging Het
Alx1 A T 10: 102,845,053 (GRCm39) M326K probably damaging Het
Ankhd1 A T 18: 36,758,258 (GRCm39) D984V probably damaging Het
Asb15 A G 6: 24,562,644 (GRCm39) N202S probably benign Het
Ate1 A T 7: 130,121,157 (GRCm39) V12E probably damaging Het
Atl2 A T 17: 80,167,260 (GRCm39) Y254N probably damaging Het
Atp13a5 A G 16: 29,116,226 (GRCm39) M630T probably benign Het
Atp5po A T 16: 91,723,417 (GRCm39) I124N possibly damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bicdl1 T C 5: 115,799,546 (GRCm39) E181G probably damaging Het
Bnipl C A 3: 95,151,486 (GRCm39) W272L probably damaging Het
Catsperd A T 17: 56,971,072 (GRCm39) H712L probably benign Het
Cilp2 T C 8: 70,334,997 (GRCm39) D667G possibly damaging Het
Cntn4 A C 6: 106,500,575 (GRCm39) K351Q probably damaging Het
Coq7 A T 7: 118,125,111 (GRCm39) I171N probably damaging Het
Csf2rb T A 15: 78,228,771 (GRCm39) F371I probably benign Het
Cyp3a13 C T 5: 137,897,136 (GRCm39) V393M possibly damaging Het
Dennd2a A G 6: 39,470,000 (GRCm39) V564A probably damaging Het
Ear14 T C 14: 51,441,468 (GRCm39) L108P probably damaging Het
Egflam C A 15: 7,283,227 (GRCm39) V277F probably null Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Faap100 T C 11: 120,265,089 (GRCm39) M596V probably benign Het
Fbxw15 T A 9: 109,386,330 (GRCm39) T270S possibly damaging Het
Gabpb1 C T 2: 126,481,120 (GRCm39) C342Y possibly damaging Het
Gls A T 1: 52,251,492 (GRCm39) C288* probably null Het
Grm8 G T 6: 27,285,786 (GRCm39) D875E probably benign Het
Hdac4 C A 1: 91,903,387 (GRCm39) R514L probably benign Het
Hps4 T A 5: 112,518,388 (GRCm39) N460K probably benign Het
Inpp5d T C 1: 87,627,394 (GRCm39) F565S probably damaging Het
Kcp T C 6: 29,497,764 (GRCm39) N499S probably damaging Het
Klk15 T C 7: 43,588,980 (GRCm39) L244S probably benign Het
Lamp3 A T 16: 19,518,440 (GRCm39) S266T possibly damaging Het
Lemd3 A G 10: 120,761,678 (GRCm39) F863L probably damaging Het
Mga T A 2: 119,747,838 (GRCm39) V663D probably damaging Het
Naa15 A G 3: 51,378,904 (GRCm39) probably null Het
Ndrg3 C A 2: 156,770,733 (GRCm39) G352* probably null Het
Nr2f6 G T 8: 71,828,595 (GRCm39) N233K possibly damaging Het
Or4a79 A G 2: 89,551,879 (GRCm39) F192S probably benign Het
Plxnb2 T A 15: 89,041,225 (GRCm39) M1774L possibly damaging Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Rpl23a G A 11: 78,073,654 (GRCm39) R62W probably benign Het
Rubcnl A G 14: 75,269,530 (GRCm39) R63G probably damaging Het
Ryr1 T C 7: 28,767,055 (GRCm39) D2976G probably damaging Het
Siglec1 A G 2: 130,923,258 (GRCm39) Y496H probably damaging Het
Sipa1l2 A G 8: 126,218,566 (GRCm39) V257A possibly damaging Het
Slc24a4 T C 12: 102,201,112 (GRCm39) probably null Het
Slc4a1ap T C 5: 31,684,822 (GRCm39) S153P probably damaging Het
Slc4a4 A T 5: 89,376,791 (GRCm39) E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 (GRCm39) E2845A possibly damaging Het
Tlr1 T C 5: 65,084,079 (GRCm39) N166S possibly damaging Het
Tmem231 C T 8: 112,644,922 (GRCm39) probably null Het
Tsc2 C A 17: 24,827,089 (GRCm39) L873F possibly damaging Het
Unc13b T G 4: 43,259,546 (GRCm39) S1403A possibly damaging Het
Vmn1r7 A G 6: 57,001,553 (GRCm39) F236L probably benign Het
Vmn2r111 T C 17: 22,789,714 (GRCm39) S431G probably benign Het
Wdr7 A T 18: 63,910,860 (GRCm39) K751* probably null Het
Wdr90 C T 17: 26,065,300 (GRCm39) R1652Q probably damaging Het
Zcchc2 T C 1: 105,931,895 (GRCm39) Y366H probably damaging Het
Zfp1005 A T 2: 150,109,577 (GRCm39) H89L possibly damaging Het
Zfp607a C T 7: 27,565,000 (GRCm39) R56C possibly damaging Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74,944,570 (GRCm39) missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75,160,963 (GRCm39) critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74,945,171 (GRCm39) missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75,054,450 (GRCm39) missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75,161,120 (GRCm39) missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75,054,399 (GRCm39) missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 75,023,267 (GRCm39) missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74,945,101 (GRCm39) missense probably benign 0.05
IGL01642:Kcnh5 APN 12 75,011,943 (GRCm39) missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75,161,274 (GRCm39) nonsense probably null
IGL01733:Kcnh5 APN 12 75,011,966 (GRCm39) missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74,944,322 (GRCm39) missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75,134,379 (GRCm39) missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74,944,426 (GRCm39) missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75,223,312 (GRCm39) utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 75,023,471 (GRCm39) missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75,054,439 (GRCm39) missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75,161,171 (GRCm39) missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75,161,188 (GRCm39) missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75,184,447 (GRCm39) missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75,161,323 (GRCm39) missense probably damaging 1.00
R0590:Kcnh5 UTSW 12 75,012,035 (GRCm39) missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 75,023,305 (GRCm39) missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 75,023,305 (GRCm39) missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75,166,711 (GRCm39) missense probably benign
R1728:Kcnh5 UTSW 12 75,184,465 (GRCm39) missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75,161,003 (GRCm39) missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75,184,465 (GRCm39) missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74,944,358 (GRCm39) missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74,944,358 (GRCm39) missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74,945,230 (GRCm39) critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75,177,705 (GRCm39) missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75,054,493 (GRCm39) missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75,054,493 (GRCm39) missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75,161,245 (GRCm39) missense probably damaging 1.00
R2655:Kcnh5 UTSW 12 75,161,314 (GRCm39) missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75,134,350 (GRCm39) missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74,945,044 (GRCm39) missense probably benign
R4681:Kcnh5 UTSW 12 75,054,397 (GRCm39) missense probably benign 0.00
R4728:Kcnh5 UTSW 12 75,054,555 (GRCm39) missense probably damaging 1.00
R4965:Kcnh5 UTSW 12 75,011,925 (GRCm39) missense probably benign 0.11
R5127:Kcnh5 UTSW 12 74,944,858 (GRCm39) missense probably benign 0.17
R5267:Kcnh5 UTSW 12 75,134,190 (GRCm39) missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75,177,681 (GRCm39) missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 75,023,463 (GRCm39) missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75,184,423 (GRCm39) missense probably damaging 1.00
R5747:Kcnh5 UTSW 12 74,945,194 (GRCm39) missense probably benign 0.04
R6123:Kcnh5 UTSW 12 75,134,365 (GRCm39) missense probably benign 0.01
R6545:Kcnh5 UTSW 12 75,054,432 (GRCm39) missense probably damaging 1.00
R6662:Kcnh5 UTSW 12 75,054,385 (GRCm39) missense probably damaging 1.00
R7117:Kcnh5 UTSW 12 75,161,219 (GRCm39) missense possibly damaging 0.87
R7161:Kcnh5 UTSW 12 74,944,483 (GRCm39) missense probably benign 0.10
R7437:Kcnh5 UTSW 12 75,184,417 (GRCm39) critical splice donor site probably null
R7557:Kcnh5 UTSW 12 75,054,399 (GRCm39) missense possibly damaging 0.62
R7566:Kcnh5 UTSW 12 75,161,166 (GRCm39) nonsense probably null
R7591:Kcnh5 UTSW 12 75,054,541 (GRCm39) missense probably benign 0.24
R7816:Kcnh5 UTSW 12 75,023,457 (GRCm39) missense probably damaging 1.00
R8152:Kcnh5 UTSW 12 74,944,633 (GRCm39) missense possibly damaging 0.68
R8390:Kcnh5 UTSW 12 75,134,532 (GRCm39) missense probably damaging 1.00
R8560:Kcnh5 UTSW 12 75,023,379 (GRCm39) missense probably damaging 1.00
R9056:Kcnh5 UTSW 12 74,944,774 (GRCm39) missense probably benign 0.00
R9064:Kcnh5 UTSW 12 75,177,727 (GRCm39) nonsense probably null
R9283:Kcnh5 UTSW 12 75,023,307 (GRCm39) missense probably damaging 1.00
R9290:Kcnh5 UTSW 12 75,023,488 (GRCm39) missense probably benign 0.00
R9552:Kcnh5 UTSW 12 75,023,334 (GRCm39) missense probably benign 0.28
R9576:Kcnh5 UTSW 12 74,944,307 (GRCm39) missense probably benign 0.00
R9627:Kcnh5 UTSW 12 75,160,990 (GRCm39) missense probably damaging 0.99
R9645:Kcnh5 UTSW 12 75,134,191 (GRCm39) missense probably benign 0.32
R9650:Kcnh5 UTSW 12 75,023,293 (GRCm39) missense probably benign 0.32
Z1088:Kcnh5 UTSW 12 75,012,069 (GRCm39) missense possibly damaging 0.78
Z1088:Kcnh5 UTSW 12 74,944,535 (GRCm39) missense probably benign 0.00
Z1177:Kcnh5 UTSW 12 75,161,296 (GRCm39) missense probably damaging 1.00
Z1177:Kcnh5 UTSW 12 75,054,571 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TAACTTCCAAGGACCCGGAC -3'
(R):5'- GTGACACGGACTGCATTGTG -3'

Sequencing Primer
(F):5'- CGGACACCACAAAGCAGAGG -3'
(R):5'- ACCAGACTTCAGTTTCCTTGAGGG -3'
Posted On 2019-11-26