Incidental Mutation 'R7781:Plxnb2'
ID599260
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89157022 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1774 (M1774L)
Ref Sequence ENSEMBL: ENSMUSP00000051731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060808
AA Change: M1774L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: M1774L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109331
AA Change: M1774L

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: M1774L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bicdl1 T C 5: 115,661,487 E181G probably damaging Het
Bnipl C A 3: 95,244,175 W272L probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Coq7 A T 7: 118,525,888 I171N probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Faap100 T C 11: 120,374,263 M596V probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lamp3 A T 16: 19,699,690 S266T possibly damaging Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Olfr1252 A G 2: 89,721,535 F192S probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tmem231 C T 8: 111,918,290 probably null Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zcchc2 T C 1: 106,004,165 Y366H probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R8126:Plxnb2 UTSW 15 89163303 missense probably benign
R8131:Plxnb2 UTSW 15 89158713 missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R8736:Plxnb2 UTSW 15 89162058 missense probably damaging 1.00
R8772:Plxnb2 UTSW 15 89162746 missense probably damaging 1.00
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGGTCAAGGCAGCTTGC -3'
(R):5'- AAAAGCTTTTGTCTTCCGCAG -3'

Sequencing Primer
(F):5'- GCAGCTTGCCTGTCCCAC -3'
(R):5'- TCTCTACCTACAAGAAGATGGTGG -3'
Posted On2019-11-26