Incidental Mutation 'R7781:Lamp3'
ID599261
Institutional Source Beutler Lab
Gene Symbol Lamp3
Ensembl Gene ENSMUSG00000041247
Gene Namelysosomal-associated membrane protein 3
SynonymsCd208, DC-LAMP, 1200002D17Rik, TSC403
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7781 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location19653378-19706375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19699690 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 266 (S266T)
Ref Sequence ENSEMBL: ENSMUSP00000080556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081880
AA Change: S266T

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080556
Gene: ENSMUSG00000041247
AA Change: S266T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lamp 103 411 5.6e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dendritic cells (DCs) are the most potent antigen-presenting cells. Immature DCs efficiently capture antigens and differentiate into interdigitating dendritic cells (IDCs) in lymphoid tissues that induce primary T-cell responses (summary by de Saint-Vis et al., 1998 [PubMed 9768752]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik G A 3: 19,628,542 P23S unknown Het
Abcc6 C T 7: 46,005,606 R487Q probably damaging Het
Abl1 A T 2: 31,790,697 T334S probably damaging Het
Adam6b T C 12: 113,491,342 F593S probably damaging Het
Alx1 A T 10: 103,009,192 M326K probably damaging Het
Ankhd1 A T 18: 36,625,205 D984V probably damaging Het
Asb15 A G 6: 24,562,645 N202S probably benign Het
Ate1 A T 7: 130,519,427 V12E probably damaging Het
Atl2 A T 17: 79,859,831 Y254N probably damaging Het
Atp13a5 A G 16: 29,297,408 M630T probably benign Het
Atp5o A T 16: 91,926,529 I124N possibly damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bicdl1 T C 5: 115,661,487 E181G probably damaging Het
Bnipl C A 3: 95,244,175 W272L probably damaging Het
Catsperd A T 17: 56,664,072 H712L probably benign Het
Cilp2 T C 8: 69,882,347 D667G possibly damaging Het
Cntn4 A C 6: 106,523,614 K351Q probably damaging Het
Coq7 A T 7: 118,525,888 I171N probably damaging Het
Csf2rb T A 15: 78,344,571 F371I probably benign Het
Cyp3a13 C T 5: 137,898,874 V393M possibly damaging Het
Dennd2a A G 6: 39,493,066 V564A probably damaging Het
Ear14 T C 14: 51,204,011 L108P probably damaging Het
Egflam C A 15: 7,253,746 V277F probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Faap100 T C 11: 120,374,263 M596V probably benign Het
Fbxw15 T A 9: 109,557,262 T270S possibly damaging Het
Gabpb1 C T 2: 126,639,200 C342Y possibly damaging Het
Gls A T 1: 52,212,333 C288* probably null Het
Gm14124 A T 2: 150,267,657 H89L possibly damaging Het
Grm8 G T 6: 27,285,787 D875E probably benign Het
Hdac4 C A 1: 91,975,665 R514L probably benign Het
Hps4 T A 5: 112,370,522 N460K probably benign Het
Inpp5d T C 1: 87,699,672 F565S probably damaging Het
Kcnh5 C A 12: 74,976,681 V538F probably damaging Het
Kcp T C 6: 29,497,765 N499S probably damaging Het
Klk15 T C 7: 43,939,556 L244S probably benign Het
Lemd3 A G 10: 120,925,773 F863L probably damaging Het
Mga T A 2: 119,917,357 V663D probably damaging Het
Naa15 A G 3: 51,471,483 probably null Het
Ndrg3 C A 2: 156,928,813 G352* probably null Het
Nr2f6 G T 8: 71,375,951 N233K possibly damaging Het
Olfr1252 A G 2: 89,721,535 F192S probably benign Het
Plxnb2 T A 15: 89,157,022 M1774L possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rpl23a G A 11: 78,182,828 R62W probably benign Het
Rubcnl A G 14: 75,032,090 R63G probably damaging Het
Ryr1 T C 7: 29,067,630 D2976G probably damaging Het
Siglec1 A G 2: 131,081,338 Y496H probably damaging Het
Sipa1l2 A G 8: 125,491,827 V257A possibly damaging Het
Slc24a4 T C 12: 102,234,853 probably null Het
Slc4a1ap T C 5: 31,527,478 S153P probably damaging Het
Slc4a4 A T 5: 89,228,932 E1006V possibly damaging Het
Svep1 T G 4: 58,069,251 E2845A possibly damaging Het
Tlr1 T C 5: 64,926,736 N166S possibly damaging Het
Tmem231 C T 8: 111,918,290 probably null Het
Tsc2 C A 17: 24,608,115 L873F possibly damaging Het
Unc13b T G 4: 43,259,546 S1403A possibly damaging Het
Vmn1r7 A G 6: 57,024,568 F236L probably benign Het
Vmn2r111 T C 17: 22,570,733 S431G probably benign Het
Wdr7 A T 18: 63,777,789 K751* probably null Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zcchc2 T C 1: 106,004,165 Y366H probably damaging Het
Zfp607a C T 7: 27,865,575 R56C possibly damaging Het
Other mutations in Lamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Lamp3 APN 16 19673419 missense probably damaging 1.00
IGL02505:Lamp3 APN 16 19655457 missense possibly damaging 0.48
IGL02892:Lamp3 APN 16 19676052 missense probably damaging 1.00
IGL03228:Lamp3 APN 16 19676067 missense possibly damaging 0.94
PIT4453001:Lamp3 UTSW 16 19673460 missense probably benign 0.14
R0295:Lamp3 UTSW 16 19701108 nonsense probably null
R0419:Lamp3 UTSW 16 19673552 missense probably damaging 1.00
R1568:Lamp3 UTSW 16 19673525 missense probably damaging 1.00
R1702:Lamp3 UTSW 16 19676072 missense probably benign 0.11
R2018:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R2019:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R4072:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4073:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4075:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4076:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4333:Lamp3 UTSW 16 19673436 missense probably benign 0.02
R4457:Lamp3 UTSW 16 19673529 missense probably benign 0.19
R4868:Lamp3 UTSW 16 19701290 missense probably benign 0.01
R4876:Lamp3 UTSW 16 19655470 missense probably damaging 0.97
R5766:Lamp3 UTSW 16 19701317 missense probably damaging 0.99
R5832:Lamp3 UTSW 16 19701320 missense probably damaging 0.98
R5997:Lamp3 UTSW 16 19701028 missense probably benign 0.22
R6000:Lamp3 UTSW 16 19700948 missense possibly damaging 0.88
R6088:Lamp3 UTSW 16 19673398 missense probably damaging 1.00
R6332:Lamp3 UTSW 16 19699681 missense probably damaging 1.00
R6636:Lamp3 UTSW 16 19701233 missense probably benign
R6637:Lamp3 UTSW 16 19701233 missense probably benign
R6881:Lamp3 UTSW 16 19699618 missense probably benign 0.39
R6966:Lamp3 UTSW 16 19699653 nonsense probably null
R7002:Lamp3 UTSW 16 19655422 missense possibly damaging 0.89
R7067:Lamp3 UTSW 16 19699663 missense probably damaging 0.99
R7425:Lamp3 UTSW 16 19699612 critical splice donor site probably null
R7866:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7894:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7912:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R7949:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7977:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7993:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R8036:Lamp3 UTSW 16 19701059 missense probably damaging 1.00
RF018:Lamp3 UTSW 16 19701250 missense probably benign
X0025:Lamp3 UTSW 16 19701056 missense possibly damaging 0.82
X0063:Lamp3 UTSW 16 19700885 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATCTAGCTTGAAATTTAGCACTG -3'
(R):5'- ATGATGTCACACAATTGGGGAG -3'

Sequencing Primer
(F):5'- TGAATCACTGGCACTAGACTG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2019-11-26