Mutagenetix > Incidental Mutation

Incidental Mutation 'R7781:Vmn2r111'

599264

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R7781 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22570733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 431 (S431G)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: S431G

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: S431G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700064H15Rik	G	A	3: 19,628,542	P23S	unknown	Het
Abcc6	C	T	7: 46,005,606	R487Q	probably damaging	Het
Abl1	A	T	2: 31,790,697	T334S	probably damaging	Het
Adam6b	T	C	12: 113,491,342	F593S	probably damaging	Het
Alx1	A	T	10: 103,009,192	M326K	probably damaging	Het
Ankhd1	A	T	18: 36,625,205	D984V	probably damaging	Het
Asb15	A	G	6: 24,562,645	N202S	probably benign	Het
Ate1	A	T	7: 130,519,427	V12E	probably damaging	Het
Atl2	A	T	17: 79,859,831	Y254N	probably damaging	Het
Atp13a5	A	G	16: 29,297,408	M630T	probably benign	Het
Atp5o	A	T	16: 91,926,529	I124N	possibly damaging	Het
BC005537	C	T	13: 24,803,399	R7W	possibly damaging	Het
Bicdl1	T	C	5: 115,661,487	E181G	probably damaging	Het
Bnipl	C	A	3: 95,244,175	W272L	probably damaging	Het
Catsperd	A	T	17: 56,664,072	H712L	probably benign	Het
Cilp2	T	C	8: 69,882,347	D667G	possibly damaging	Het
Cntn4	A	C	6: 106,523,614	K351Q	probably damaging	Het
Coq7	A	T	7: 118,525,888	I171N	probably damaging	Het
Csf2rb	T	A	15: 78,344,571	F371I	probably benign	Het
Cyp3a13	C	T	5: 137,898,874	V393M	possibly damaging	Het
Dennd2a	A	G	6: 39,493,066	V564A	probably damaging	Het
Ear14	T	C	14: 51,204,011	L108P	probably damaging	Het
Egflam	C	A	15: 7,253,746	V277F	probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Faap100	T	C	11: 120,374,263	M596V	probably benign	Het
Fbxw15	T	A	9: 109,557,262	T270S	possibly damaging	Het
Gabpb1	C	T	2: 126,639,200	C342Y	possibly damaging	Het
Gls	A	T	1: 52,212,333	C288*	probably null	Het
Gm14124	A	T	2: 150,267,657	H89L	possibly damaging	Het
Grm8	G	T	6: 27,285,787	D875E	probably benign	Het
Hdac4	C	A	1: 91,975,665	R514L	probably benign	Het
Hps4	T	A	5: 112,370,522	N460K	probably benign	Het
Inpp5d	T	C	1: 87,699,672	F565S	probably damaging	Het
Kcnh5	C	A	12: 74,976,681	V538F	probably damaging	Het
Kcp	T	C	6: 29,497,765	N499S	probably damaging	Het
Klk15	T	C	7: 43,939,556	L244S	probably benign	Het
Lamp3	A	T	16: 19,699,690	S266T	possibly damaging	Het
Lemd3	A	G	10: 120,925,773	F863L	probably damaging	Het
Mga	T	A	2: 119,917,357	V663D	probably damaging	Het
Naa15	A	G	3: 51,471,483		probably null	Het
Ndrg3	C	A	2: 156,928,813	G352*	probably null	Het
Nr2f6	G	T	8: 71,375,951	N233K	possibly damaging	Het
Olfr1252	A	G	2: 89,721,535	F192S	probably benign	Het
Plxnb2	T	A	15: 89,157,022	M1774L	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rpl23a	G	A	11: 78,182,828	R62W	probably benign	Het
Rubcnl	A	G	14: 75,032,090	R63G	probably damaging	Het
Ryr1	T	C	7: 29,067,630	D2976G	probably damaging	Het
Siglec1	A	G	2: 131,081,338	Y496H	probably damaging	Het
Sipa1l2	A	G	8: 125,491,827	V257A	possibly damaging	Het
Slc24a4	T	C	12: 102,234,853		probably null	Het
Slc4a1ap	T	C	5: 31,527,478	S153P	probably damaging	Het
Slc4a4	A	T	5: 89,228,932	E1006V	possibly damaging	Het
Svep1	T	G	4: 58,069,251	E2845A	possibly damaging	Het
Tlr1	T	C	5: 64,926,736	N166S	possibly damaging	Het
Tmem231	C	T	8: 111,918,290		probably null	Het
Tsc2	C	A	17: 24,608,115	L873F	possibly damaging	Het
Unc13b	T	G	4: 43,259,546	S1403A	possibly damaging	Het
Vmn1r7	A	G	6: 57,024,568	F236L	probably benign	Het
Wdr7	A	T	18: 63,777,789	K751*	probably null	Het
Wdr90	C	T	17: 25,846,326	R1652Q	probably damaging	Het
Zcchc2	T	C	1: 106,004,165	Y366H	probably damaging	Het
Zfp607a	C	T	7: 27,865,575	R56C	possibly damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGGTATACAAGGACAGATTATGCC -3'
(R):5'- TAAGACACTGAAGAACTGCTCATC -3'

Sequencing Primer
(F):5'- CAAGGACAGATTATGCCTTCTAGTC -3'
(R):5'- GAACTGCTCATCCAATCACTCATTG -3'

Posted On

2019-11-26