Incidental Mutation 'R7782:Dnajc5b'
ID599280
Institutional Source Beutler Lab
Gene Symbol Dnajc5b
Ensembl Gene ENSMUSG00000027606
Gene NameDnaJ heat shock protein family (Hsp40) member C5 beta
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7782 (G1)
Quality Score81.0075
Status Not validated
Chromosome3
Chromosomal Location19508595-19610862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19574842 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 100 (N100S)
Ref Sequence ENSEMBL: ENSMUSP00000029132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029132] [ENSMUST00000118735] [ENSMUST00000118968] [ENSMUST00000165693]
Predicted Effect probably benign
Transcript: ENSMUST00000029132
AA Change: N100S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000029132
Gene: ENSMUSG00000027606
AA Change: N100S

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118735
AA Change: N100S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113414
Gene: ENSMUSG00000027606
AA Change: N100S

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118968
AA Change: N100S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112849
Gene: ENSMUSG00000027606
AA Change: N100S

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165693
AA Change: N100S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000127515
Gene: ENSMUSG00000027606
AA Change: N100S

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of co-chaperone proteins that is characterized by an N-terminal DNAJ domain, a linker region, and a cysteine-rich C-terminal domain. The encoded protein, together with heat shock protein 70, is thought to regulate the proper folding of other proteins. The orthologous mouse protein is membrane-associated and is targeted to the trans-golgi network. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,226 L758P probably damaging Het
4933415A04Rik GTGTGTGTATGTGTGT GTGTGTGT 11: 43,587,412 probably null Het
Adamts16 A G 13: 70,836,146 S133P probably damaging Het
Adamts17 T C 7: 67,125,054 W1001R probably damaging Het
B4galnt4 C T 7: 141,065,075 P221S probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
BC034090 T C 1: 155,232,664 probably benign Het
Best2 T A 8: 85,009,514 D312V probably damaging Het
Bod1l A T 5: 41,817,943 D2009E probably benign Het
Ccdc158 A C 5: 92,645,514 S672A probably benign Het
Ccdc43 A T 11: 102,697,617 L31Q probably damaging Het
Chaf1a T G 17: 56,062,291 H507Q probably benign Het
Clptm1l A G 13: 73,604,320 Y28C probably damaging Het
Cp G A 3: 19,975,059 probably null Het
Crocc C T 4: 141,025,286 A1432T probably benign Het
Crybg2 A G 4: 134,073,826 T457A probably benign Het
Dennd4a A G 9: 64,906,920 D1473G probably damaging Het
Diaph3 A G 14: 87,037,504 F172S probably benign Het
Dusp13 G A 14: 21,741,336 T16I possibly damaging Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Fam208a A G 14: 27,471,944 T1034A probably benign Het
Fat1 A G 8: 44,950,911 Y233C probably damaging Het
Fcgbp T A 7: 28,085,035 Y173* probably null Het
Fign T A 2: 63,979,162 D588V probably damaging Het
Fignl2 C T 15: 101,053,307 V365M unknown Het
Fnip2 A C 3: 79,508,123 Y203D probably benign Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gfral C A 9: 76,193,290 V289L probably benign Het
Gm10031 C T 1: 156,524,982 T251I probably damaging Het
Heatr5b G T 17: 78,795,941 T1161K probably damaging Het
Hectd4 A T 5: 121,305,721 I1335F possibly damaging Het
Htt T A 5: 34,882,992 V2166D probably benign Het
Ipo5 G C 14: 120,933,125 K436N possibly damaging Het
Itga6 A G 2: 71,841,535 E794G probably damaging Het
Itga9 G A 9: 118,843,644 C148Y Het
Kcnip2 A C 19: 45,797,085 probably null Het
Kcnk6 T C 7: 29,225,844 T116A possibly damaging Het
Kctd21 A G 7: 97,348,090 I257V probably benign Het
Kif19a G A 11: 114,781,922 R299Q probably damaging Het
Kifc2 G A 15: 76,664,128 G391R probably benign Het
Klrg2 A G 6: 38,627,627 V381A possibly damaging Het
Olfr1340 T C 4: 118,726,909 Y221H probably damaging Het
Olfr1356 T C 10: 78,847,613 I101V probably benign Het
Olfr790 T C 10: 129,501,151 V81A probably benign Het
Olfr816 T G 10: 129,911,523 S252R probably damaging Het
Oxsm C A 14: 16,240,925 A375S possibly damaging Het
Pcdha3 T C 18: 36,948,140 V645A probably damaging Het
Pcdhb15 T A 18: 37,474,735 V340E possibly damaging Het
Pced1a G A 2: 130,422,515 P132S probably damaging Het
Pla2r1 C T 2: 60,504,187 V414M probably benign Het
Plekhg4 A C 8: 105,377,767 I493L probably benign Het
Plekhj1 T A 10: 80,798,345 probably benign Het
Pmfbp1 G T 8: 109,527,780 K482N probably damaging Het
Ppil3 T C 1: 58,434,415 N92S probably benign Het
Ppt2 A G 17: 34,625,712 S156P probably benign Het
Prss41 A T 17: 23,837,113 D255E probably benign Het
Psg25 T A 7: 18,521,302 M430L probably benign Het
Rffl A T 11: 82,812,769 C109* probably null Het
Rock2 A G 12: 16,971,110 E991G probably benign Het
Rpap2 A G 5: 107,620,192 I299V probably benign Het
Rras T C 7: 45,021,105 S158P probably benign Het
Smyd3 A T 1: 178,972,294 I360N possibly damaging Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Tbc1d31 C A 15: 57,958,368 T813K possibly damaging Het
Trav7n-4 A G 14: 53,091,646 M38V probably benign Het
Tulp3 A C 6: 128,324,980 N359K possibly damaging Het
Twf1 T C 15: 94,582,773 K196E probably benign Het
Usp24 A T 4: 106,316,574 N35Y probably damaging Het
Usp46 T A 5: 74,002,111 E342D probably benign Het
Vps50 T A 6: 3,532,202 probably null Het
Vps8 T A 16: 21,511,558 I727N possibly damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zfp11 A T 5: 129,656,963 V478E possibly damaging Het
Zfp493 A G 13: 67,787,004 K359E probably benign Het
Zfp536 T C 7: 37,568,701 Y430C probably damaging Het
Zfpm1 A G 8: 122,336,950 D916G unknown Het
Other mutations in Dnajc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1630:Dnajc5b UTSW 3 19574741 missense probably damaging 1.00
R1714:Dnajc5b UTSW 3 19579101 nonsense probably null
R3011:Dnajc5b UTSW 3 19546802 missense probably damaging 1.00
R3859:Dnajc5b UTSW 3 19574802 nonsense probably null
R5268:Dnajc5b UTSW 3 19579060 missense probably benign 0.00
R5281:Dnajc5b UTSW 3 19610560 missense probably benign 0.37
R5337:Dnajc5b UTSW 3 19574782 missense probably damaging 1.00
R5929:Dnajc5b UTSW 3 19546855 missense probably damaging 1.00
R7081:Dnajc5b UTSW 3 19546861 critical splice donor site probably null
R7770:Dnajc5b UTSW 3 19579017 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TAGGGAGCTAATACTTTTCTCCTTG -3'
(R):5'- GCTTTCAGAGGAAGCGATGTC -3'

Sequencing Primer
(F):5'- TTAAAAGAAAATTAGCCCTGCGAC -3'
(R):5'- CGATGTCGCATTTTATTTACAAGAG -3'
Posted On2019-11-26