Incidental Mutation 'R7782:4931409K22Rik'
ID599287
Institutional Source Beutler Lab
Gene Symbol 4931409K22Rik
Ensembl Gene ENSMUSG00000038199
Gene NameRIKEN cDNA 4931409K22 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R7782 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24543432-24556809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24544226 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 758 (L758P)
Ref Sequence ENSEMBL: ENSMUSP00000085642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048302] [ENSMUST00000088302] [ENSMUST00000117900] [ENSMUST00000119657] [ENSMUST00000200634]
Predicted Effect probably benign
Transcript: ENSMUST00000048302
SMART Domains Protein: ENSMUSP00000041539
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 115 144 2.62e-4 SMART
ANK 147 176 3.51e-5 SMART
ANK 180 209 7.99e2 SMART
ANK 214 243 1.44e-1 SMART
ANK 247 289 2.39e2 SMART
ANK 293 322 3.01e-4 SMART
ANK 326 362 1.46e2 SMART
SOCS_box 422 461 6.77e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088302
AA Change: L758P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199
AA Change: L758P

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117900
SMART Domains Protein: ENSMUSP00000112743
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 100 129 2.62e-4 SMART
ANK 132 161 3.51e-5 SMART
ANK 165 194 7.99e2 SMART
ANK 199 228 1.44e-1 SMART
ANK 232 274 2.39e2 SMART
ANK 278 307 3.01e-4 SMART
ANK 311 347 1.46e2 SMART
SOCS_box 407 446 6.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119657
SMART Domains Protein: ENSMUSP00000113328
Gene: ENSMUSG00000038204

DomainStartEndE-ValueType
ANK 115 144 2.62e-4 SMART
ANK 147 176 3.51e-5 SMART
ANK 180 209 7.99e2 SMART
ANK 214 243 1.44e-1 SMART
ANK 247 289 2.39e2 SMART
ANK 293 322 3.01e-4 SMART
ANK 326 362 1.46e2 SMART
SOCS_box 384 423 6.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200634
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933415A04Rik GTGTGTGTATGTGTGT GTGTGTGT 11: 43,587,412 probably null Het
5430419D17Rik G A 7: 131,302,737 probably null Het
Adamts16 A G 13: 70,836,146 S133P probably damaging Het
Adamts17 T C 7: 67,125,054 W1001R probably damaging Het
Aox4 T A 1: 58,231,092 probably null Het
B4galnt4 C T 7: 141,065,075 P221S probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
BC034090 T C 1: 155,232,664 probably benign Het
Best2 T A 8: 85,009,514 D312V probably damaging Het
Bod1l A T 5: 41,817,943 D2009E probably benign Het
Ccdc158 A C 5: 92,645,514 S672A probably benign Het
Ccdc43 A T 11: 102,697,617 L31Q probably damaging Het
Chaf1a T G 17: 56,062,291 H507Q probably benign Het
Clptm1l A G 13: 73,604,320 Y28C probably damaging Het
Cp G A 3: 19,975,059 probably null Het
Crocc C T 4: 141,025,286 A1432T probably benign Het
Crybg2 A G 4: 134,073,826 T457A probably benign Het
Dennd4a A G 9: 64,906,920 D1473G probably damaging Het
Diaph3 A G 14: 87,037,504 F172S probably benign Het
Dnajc5b A G 3: 19,574,842 N100S probably benign Het
Dusp13 G A 14: 21,741,336 T16I possibly damaging Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Fam208a A G 14: 27,471,944 T1034A probably benign Het
Fat1 A G 8: 44,950,911 Y233C probably damaging Het
Fcgbp T A 7: 28,085,035 Y173* probably null Het
Fign T A 2: 63,979,162 D588V probably damaging Het
Fignl2 C T 15: 101,053,307 V365M unknown Het
Fnip2 A C 3: 79,508,123 Y203D probably benign Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gfral C A 9: 76,193,290 V289L probably benign Het
Gm10031 C T 1: 156,524,982 T251I probably damaging Het
Heatr5b G T 17: 78,795,941 T1161K probably damaging Het
Hectd4 A T 5: 121,305,721 I1335F possibly damaging Het
Hist2h2be T A 3: 96,221,171 probably null Het
Htt T A 5: 34,882,992 V2166D probably benign Het
Ipo5 G C 14: 120,933,125 K436N possibly damaging Het
Itga6 A G 2: 71,841,535 E794G probably damaging Het
Itga9 G A 9: 118,843,644 C148Y Het
Kcnip2 A C 19: 45,797,085 probably null Het
Kcnk6 T C 7: 29,225,844 T116A possibly damaging Het
Kctd21 A G 7: 97,348,090 I257V probably benign Het
Kif19a G A 11: 114,781,922 R299Q probably damaging Het
Kifc2 G A 15: 76,664,128 G391R probably benign Het
Klrg2 A G 6: 38,627,627 V381A possibly damaging Het
Mob1b A G 5: 88,749,683 probably null Het
Olfr1340 T C 4: 118,726,909 Y221H probably damaging Het
Olfr1356 T C 10: 78,847,613 I101V probably benign Het
Olfr790 T C 10: 129,501,151 V81A probably benign Het
Olfr816 T G 10: 129,911,523 S252R probably damaging Het
Oxsm C A 14: 16,240,925 A375S possibly damaging Het
Pcdha3 T C 18: 36,948,140 V645A probably damaging Het
Pcdhb15 T A 18: 37,474,735 V340E possibly damaging Het
Pced1a G A 2: 130,422,515 P132S probably damaging Het
Pla2r1 C T 2: 60,504,187 V414M probably benign Het
Plekhg4 A C 8: 105,377,767 I493L probably benign Het
Plekhj1 T A 10: 80,798,345 probably benign Het
Pmfbp1 G T 8: 109,527,780 K482N probably damaging Het
Ppil3 T C 1: 58,434,415 N92S probably benign Het
Ppt2 A G 17: 34,625,712 S156P probably benign Het
Prss41 A T 17: 23,837,113 D255E probably benign Het
Psg25 T A 7: 18,521,302 M430L probably benign Het
Rffl A T 11: 82,812,769 C109* probably null Het
Rock2 A G 12: 16,971,110 E991G probably benign Het
Rpap2 A G 5: 107,620,192 I299V probably benign Het
Rras T C 7: 45,021,105 S158P probably benign Het
Serpinb10 G A 1: 107,535,466 probably benign Het
Smyd3 A T 1: 178,972,294 I360N possibly damaging Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Tbc1d31 C A 15: 57,958,368 T813K possibly damaging Het
Trav7n-4 A G 14: 53,091,646 M38V probably benign Het
Tulp3 A C 6: 128,324,980 N359K possibly damaging Het
Twf1 T C 15: 94,582,773 K196E probably benign Het
Usp24 A T 4: 106,316,574 N35Y probably damaging Het
Usp46 T A 5: 74,002,111 E342D probably benign Het
Vps50 T A 6: 3,532,202 probably null Het
Vps8 T A 16: 21,511,558 I727N possibly damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zfp11 A T 5: 129,656,963 V478E possibly damaging Het
Zfp493 A G 13: 67,787,004 K359E probably benign Het
Zfp536 T C 7: 37,568,701 Y430C probably damaging Het
Zfpm1 A G 8: 122,336,950 D916G unknown Het
Other mutations in 4931409K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:4931409K22Rik APN 5 24548294 missense probably benign 0.03
IGL02110:4931409K22Rik APN 5 24548084 splice site probably benign
R0329:4931409K22Rik UTSW 5 24545785 unclassified probably null
R0492:4931409K22Rik UTSW 5 24554628 missense probably damaging 1.00
R0585:4931409K22Rik UTSW 5 24550723 missense probably benign
R0656:4931409K22Rik UTSW 5 24549762 missense possibly damaging 0.67
R0894:4931409K22Rik UTSW 5 24550733 unclassified probably null
R1546:4931409K22Rik UTSW 5 24555428 utr 5 prime probably null
R1642:4931409K22Rik UTSW 5 24552688 missense probably damaging 1.00
R1998:4931409K22Rik UTSW 5 24545006 missense probably benign 0.01
R2090:4931409K22Rik UTSW 5 24550676 missense probably benign 0.15
R2186:4931409K22Rik UTSW 5 24554526 missense probably damaging 1.00
R2237:4931409K22Rik UTSW 5 24548294 missense probably benign 0.03
R2256:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R2257:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R3078:4931409K22Rik UTSW 5 24546666 missense probably benign
R3522:4931409K22Rik UTSW 5 24549626 critical splice donor site probably null
R3910:4931409K22Rik UTSW 5 24545442 splice site probably benign
R3911:4931409K22Rik UTSW 5 24545442 splice site probably benign
R4333:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4335:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4500:4931409K22Rik UTSW 5 24548277 missense possibly damaging 0.85
R4761:4931409K22Rik UTSW 5 24551983 missense probably benign
R4773:4931409K22Rik UTSW 5 24550598 critical splice donor site probably null
R4880:4931409K22Rik UTSW 5 24549752 missense probably benign
R5614:4931409K22Rik UTSW 5 24550142 missense probably benign 0.03
R5839:4931409K22Rik UTSW 5 24552026 missense probably damaging 0.98
R5847:4931409K22Rik UTSW 5 24544166 missense probably benign 0.16
R7061:4931409K22Rik UTSW 5 24545065 missense probably benign 0.00
R7131:4931409K22Rik UTSW 5 24548956 missense possibly damaging 0.81
R7156:4931409K22Rik UTSW 5 24552650 missense probably benign 0.05
R7248:4931409K22Rik UTSW 5 24544271 missense probably benign 0.00
R7480:4931409K22Rik UTSW 5 24546906 missense probably damaging 1.00
R7693:4931409K22Rik UTSW 5 24546628 missense probably benign 0.01
R7814:4931409K22Rik UTSW 5 24545422 missense possibly damaging 0.95
R7898:4931409K22Rik UTSW 5 24553645 missense probably damaging 1.00
R7981:4931409K22Rik UTSW 5 24553645 missense probably damaging 1.00
R8024:4931409K22Rik UTSW 5 24550636 missense possibly damaging 0.70
X0063:4931409K22Rik UTSW 5 24549765 splice site probably null
Z1177:4931409K22Rik UTSW 5 24550795 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCCCCAGACATTTGGAAAG -3'
(R):5'- CTGCTTGGACAAAGGCAGAG -3'

Sequencing Primer
(F):5'- TTGGAAAGCTGACTCTCCAG -3'
(R):5'- AGGCCTGGATTTTCTGCTGC -3'
Posted On2019-11-26