Incidental Mutation 'R7782:Dennd4a'
ID599312
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene NameDENN/MADD domain containing 4A
SynonymsF730015K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R7782 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64811340-64919667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64906920 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1473 (D1473G)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
Predicted Effect probably damaging
Transcript: ENSMUST00000038890
AA Change: D1473G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: D1473G

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,226 L758P probably damaging Het
4933415A04Rik GTGTGTGTATGTGTGT GTGTGTGT 11: 43,587,412 probably null Het
5430419D17Rik G A 7: 131,302,737 probably null Het
Adamts16 A G 13: 70,836,146 S133P probably damaging Het
Adamts17 T C 7: 67,125,054 W1001R probably damaging Het
Aox4 T A 1: 58,231,092 probably null Het
B4galnt4 C T 7: 141,065,075 P221S probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
BC034090 T C 1: 155,232,664 probably benign Het
Best2 T A 8: 85,009,514 D312V probably damaging Het
Bod1l A T 5: 41,817,943 D2009E probably benign Het
Ccdc158 A C 5: 92,645,514 S672A probably benign Het
Ccdc43 A T 11: 102,697,617 L31Q probably damaging Het
Chaf1a T G 17: 56,062,291 H507Q probably benign Het
Clptm1l A G 13: 73,604,320 Y28C probably damaging Het
Cp G A 3: 19,975,059 probably null Het
Crocc C T 4: 141,025,286 A1432T probably benign Het
Crybg2 A G 4: 134,073,826 T457A probably benign Het
Diaph3 A G 14: 87,037,504 F172S probably benign Het
Dnajc5b A G 3: 19,574,842 N100S probably benign Het
Dusp13 G A 14: 21,741,336 T16I possibly damaging Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Fam208a A G 14: 27,471,944 T1034A probably benign Het
Fat1 A G 8: 44,950,911 Y233C probably damaging Het
Fcgbp T A 7: 28,085,035 Y173* probably null Het
Fign T A 2: 63,979,162 D588V probably damaging Het
Fignl2 C T 15: 101,053,307 V365M unknown Het
Fnip2 A C 3: 79,508,123 Y203D probably benign Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gfral C A 9: 76,193,290 V289L probably benign Het
Gm10031 C T 1: 156,524,982 T251I probably damaging Het
Heatr5b G T 17: 78,795,941 T1161K probably damaging Het
Hectd4 A T 5: 121,305,721 I1335F possibly damaging Het
Hist2h2be T A 3: 96,221,171 probably null Het
Htt T A 5: 34,882,992 V2166D probably benign Het
Ipo5 G C 14: 120,933,125 K436N possibly damaging Het
Itga6 A G 2: 71,841,535 E794G probably damaging Het
Itga9 G A 9: 118,843,644 C148Y Het
Kcnip2 A C 19: 45,797,085 probably null Het
Kcnk6 T C 7: 29,225,844 T116A possibly damaging Het
Kctd21 A G 7: 97,348,090 I257V probably benign Het
Kif19a G A 11: 114,781,922 R299Q probably damaging Het
Kifc2 G A 15: 76,664,128 G391R probably benign Het
Klrg2 A G 6: 38,627,627 V381A possibly damaging Het
Mob1b A G 5: 88,749,683 probably null Het
Olfr1340 T C 4: 118,726,909 Y221H probably damaging Het
Olfr1356 T C 10: 78,847,613 I101V probably benign Het
Olfr790 T C 10: 129,501,151 V81A probably benign Het
Olfr816 T G 10: 129,911,523 S252R probably damaging Het
Oxsm C A 14: 16,240,925 A375S possibly damaging Het
Pcdha3 T C 18: 36,948,140 V645A probably damaging Het
Pcdhb15 T A 18: 37,474,735 V340E possibly damaging Het
Pced1a G A 2: 130,422,515 P132S probably damaging Het
Pla2r1 C T 2: 60,504,187 V414M probably benign Het
Plekhg4 A C 8: 105,377,767 I493L probably benign Het
Plekhj1 T A 10: 80,798,345 probably benign Het
Pmfbp1 G T 8: 109,527,780 K482N probably damaging Het
Ppil3 T C 1: 58,434,415 N92S probably benign Het
Ppt2 A G 17: 34,625,712 S156P probably benign Het
Prss41 A T 17: 23,837,113 D255E probably benign Het
Psg25 T A 7: 18,521,302 M430L probably benign Het
Rffl A T 11: 82,812,769 C109* probably null Het
Rock2 A G 12: 16,971,110 E991G probably benign Het
Rpap2 A G 5: 107,620,192 I299V probably benign Het
Rras T C 7: 45,021,105 S158P probably benign Het
Serpinb10 G A 1: 107,535,466 probably benign Het
Smyd3 A T 1: 178,972,294 I360N possibly damaging Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Tbc1d31 C A 15: 57,958,368 T813K possibly damaging Het
Trav7n-4 A G 14: 53,091,646 M38V probably benign Het
Tulp3 A C 6: 128,324,980 N359K possibly damaging Het
Twf1 T C 15: 94,582,773 K196E probably benign Het
Usp24 A T 4: 106,316,574 N35Y probably damaging Het
Usp46 T A 5: 74,002,111 E342D probably benign Het
Vps50 T A 6: 3,532,202 probably null Het
Vps8 T A 16: 21,511,558 I727N possibly damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zfp11 A T 5: 129,656,963 V478E possibly damaging Het
Zfp493 A G 13: 67,787,004 K359E probably benign Het
Zfp536 T C 7: 37,568,701 Y430C probably damaging Het
Zfpm1 A G 8: 122,336,950 D916G unknown Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 splice site probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64888587 missense probably benign 0.01
R7662:Dennd4a UTSW 9 64852431 missense probably damaging 1.00
R7909:Dennd4a UTSW 9 64872993 critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64852512 missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64873030 missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64888568 missense probably benign 0.01
R8089:Dennd4a UTSW 9 64849175 missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64906875 missense probably benign 0.00
R8397:Dennd4a UTSW 9 64889109 missense probably benign
R8425:Dennd4a UTSW 9 64838974 missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64886879 missense probably damaging 1.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGGCTGTATTTGCTCAGATC -3'
(R):5'- CTGTTGATGAGCTGGACTTCAAG -3'

Sequencing Primer
(F):5'- GCTCAGATCTTTTGATTATTGCCATG -3'
(R):5'- GATGAGCTGGACTTCAAGAAATATC -3'
Posted On2019-11-26