Incidental Mutation 'R7782:Gfral'
ID599313
Institutional Source Beutler Lab
Gene Symbol Gfral
Ensembl Gene ENSMUSG00000059383
Gene NameGDNF family receptor alpha like
SynonymsGRAL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7782 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location76164102-76213657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76193290 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 289 (V289L)
Ref Sequence ENSEMBL: ENSMUSP00000074421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074880] [ENSMUST00000184693]
Predicted Effect probably benign
Transcript: ENSMUST00000074880
AA Change: V289L

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074421
Gene: ENSMUSG00000059383
AA Change: V289L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
GDNF 220 316 3.15e-17 SMART
transmembrane domain 351 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184693
SMART Domains Protein: ENSMUSP00000139120
Gene: ENSMUSG00000059383

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
GDNF 24 99 4.05e0 SMART
GDNF 131 210 1.15e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased susceptibility to diet-induced obesity caused by overeating and reduced glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,544,226 L758P probably damaging Het
4933415A04Rik GTGTGTGTATGTGTGT GTGTGTGT 11: 43,587,412 probably null Het
5430419D17Rik G A 7: 131,302,737 probably null Het
Adamts16 A G 13: 70,836,146 S133P probably damaging Het
Adamts17 T C 7: 67,125,054 W1001R probably damaging Het
Aox4 T A 1: 58,231,092 probably null Het
B4galnt4 C T 7: 141,065,075 P221S probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
BC034090 T C 1: 155,232,664 probably benign Het
Best2 T A 8: 85,009,514 D312V probably damaging Het
Bod1l A T 5: 41,817,943 D2009E probably benign Het
Ccdc158 A C 5: 92,645,514 S672A probably benign Het
Ccdc43 A T 11: 102,697,617 L31Q probably damaging Het
Chaf1a T G 17: 56,062,291 H507Q probably benign Het
Clptm1l A G 13: 73,604,320 Y28C probably damaging Het
Cp G A 3: 19,975,059 probably null Het
Crocc C T 4: 141,025,286 A1432T probably benign Het
Crybg2 A G 4: 134,073,826 T457A probably benign Het
Dennd4a A G 9: 64,906,920 D1473G probably damaging Het
Diaph3 A G 14: 87,037,504 F172S probably benign Het
Dnajc5b A G 3: 19,574,842 N100S probably benign Het
Dusp13 G A 14: 21,741,336 T16I possibly damaging Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Fam208a A G 14: 27,471,944 T1034A probably benign Het
Fat1 A G 8: 44,950,911 Y233C probably damaging Het
Fcgbp T A 7: 28,085,035 Y173* probably null Het
Fign T A 2: 63,979,162 D588V probably damaging Het
Fignl2 C T 15: 101,053,307 V365M unknown Het
Fnip2 A C 3: 79,508,123 Y203D probably benign Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gm10031 C T 1: 156,524,982 T251I probably damaging Het
Heatr5b G T 17: 78,795,941 T1161K probably damaging Het
Hectd4 A T 5: 121,305,721 I1335F possibly damaging Het
Hist2h2be T A 3: 96,221,171 probably null Het
Htt T A 5: 34,882,992 V2166D probably benign Het
Ipo5 G C 14: 120,933,125 K436N possibly damaging Het
Itga6 A G 2: 71,841,535 E794G probably damaging Het
Itga9 G A 9: 118,843,644 C148Y Het
Kcnip2 A C 19: 45,797,085 probably null Het
Kcnk6 T C 7: 29,225,844 T116A possibly damaging Het
Kctd21 A G 7: 97,348,090 I257V probably benign Het
Kif19a G A 11: 114,781,922 R299Q probably damaging Het
Kifc2 G A 15: 76,664,128 G391R probably benign Het
Klrg2 A G 6: 38,627,627 V381A possibly damaging Het
Mob1b A G 5: 88,749,683 probably null Het
Olfr1340 T C 4: 118,726,909 Y221H probably damaging Het
Olfr1356 T C 10: 78,847,613 I101V probably benign Het
Olfr790 T C 10: 129,501,151 V81A probably benign Het
Olfr816 T G 10: 129,911,523 S252R probably damaging Het
Oxsm C A 14: 16,240,925 A375S possibly damaging Het
Pcdha3 T C 18: 36,948,140 V645A probably damaging Het
Pcdhb15 T A 18: 37,474,735 V340E possibly damaging Het
Pced1a G A 2: 130,422,515 P132S probably damaging Het
Pla2r1 C T 2: 60,504,187 V414M probably benign Het
Plekhg4 A C 8: 105,377,767 I493L probably benign Het
Plekhj1 T A 10: 80,798,345 probably benign Het
Pmfbp1 G T 8: 109,527,780 K482N probably damaging Het
Ppil3 T C 1: 58,434,415 N92S probably benign Het
Ppt2 A G 17: 34,625,712 S156P probably benign Het
Prss41 A T 17: 23,837,113 D255E probably benign Het
Psg25 T A 7: 18,521,302 M430L probably benign Het
Rffl A T 11: 82,812,769 C109* probably null Het
Rock2 A G 12: 16,971,110 E991G probably benign Het
Rpap2 A G 5: 107,620,192 I299V probably benign Het
Rras T C 7: 45,021,105 S158P probably benign Het
Serpinb10 G A 1: 107,535,466 probably benign Het
Smyd3 A T 1: 178,972,294 I360N possibly damaging Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Tbc1d31 C A 15: 57,958,368 T813K possibly damaging Het
Trav7n-4 A G 14: 53,091,646 M38V probably benign Het
Tulp3 A C 6: 128,324,980 N359K possibly damaging Het
Twf1 T C 15: 94,582,773 K196E probably benign Het
Usp24 A T 4: 106,316,574 N35Y probably damaging Het
Usp46 T A 5: 74,002,111 E342D probably benign Het
Vps50 T A 6: 3,532,202 probably null Het
Vps8 T A 16: 21,511,558 I727N possibly damaging Het
Wdr90 C T 17: 25,846,326 R1652Q probably damaging Het
Zfp11 A T 5: 129,656,963 V478E possibly damaging Het
Zfp493 A G 13: 67,787,004 K359E probably benign Het
Zfp536 T C 7: 37,568,701 Y430C probably damaging Het
Zfpm1 A G 8: 122,336,950 D916G unknown Het
Other mutations in Gfral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Gfral APN 9 76164825 nonsense probably null
IGL02383:Gfral APN 9 76197092 missense probably damaging 0.97
IGL02987:Gfral APN 9 76197301 missense possibly damaging 0.82
IGL03002:Gfral APN 9 76197238 missense possibly damaging 0.61
IGL03055:Gfral UTSW 9 76208549 missense probably benign 0.00
PIT4585001:Gfral UTSW 9 76197294 missense probably damaging 1.00
R0268:Gfral UTSW 9 76197101 missense probably damaging 1.00
R0547:Gfral UTSW 9 76208642 missense probably benign 0.16
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1146:Gfral UTSW 9 76167059 missense probably benign 0.00
R1275:Gfral UTSW 9 76197032 missense probably damaging 1.00
R1830:Gfral UTSW 9 76193203 missense probably benign 0.01
R2249:Gfral UTSW 9 76193349 missense probably damaging 1.00
R3709:Gfral UTSW 9 76193443 nonsense probably null
R4712:Gfral UTSW 9 76193445 missense possibly damaging 0.71
R5567:Gfral UTSW 9 76208618 missense probably benign 0.00
R5568:Gfral UTSW 9 76164805 makesense probably null
R5719:Gfral UTSW 9 76197046 missense probably benign 0.02
R5789:Gfral UTSW 9 76197046 missense probably benign 0.02
R5791:Gfral UTSW 9 76197046 missense probably benign 0.02
R7110:Gfral UTSW 9 76164830 missense possibly damaging 0.84
R7549:Gfral UTSW 9 76198975 missense probably benign 0.14
R7851:Gfral UTSW 9 76205455 missense probably benign 0.03
Z1177:Gfral UTSW 9 76205389 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCAAGCACAAATTGTCTTTATGAAC -3'
(R):5'- TTCTTCTAGGACACACTACCGAAC -3'

Sequencing Primer
(F):5'- GGTTCAGGTTGTCTGGATTACC -3'
(R):5'- TTCTAGGACACACTACCGAACATTCC -3'
Posted On2019-11-26