Incidental Mutation 'R7783:Fh1'
ID599351
Institutional Source Beutler Lab
Gene Symbol Fh1
Ensembl Gene ENSMUSG00000026526
Gene Namefumarate hydratase 1
Synonymsfumarase
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7783 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location175600374-175625635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 175612178 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 233 (T233M)
Ref Sequence ENSEMBL: ENSMUSP00000027810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027810] [ENSMUST00000154956]
Predicted Effect probably damaging
Transcript: ENSMUST00000027810
AA Change: T233M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027810
Gene: ENSMUSG00000026526
AA Change: T233M

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:Lyase_1 55 386 1.8e-124 PFAM
Pfam:FumaraseC_C 452 505 2.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154956
SMART Domains Protein: ENSMUSP00000135140
Gene: ENSMUSG00000026526

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176740
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele fail to develop past the egg-cylinder stage and die at E6.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,812 Y447* probably null Het
Abl2 T C 1: 156,559,071 V8A probably benign Het
Adam33 C T 2: 131,058,337 R103K unknown Het
Adamts13 G T 2: 26,990,585 A727S not run Het
Alpk2 A T 18: 65,306,254 C689* probably null Het
Amt C T 9: 108,297,215 Q60* probably null Het
Ankrd12 A G 17: 66,027,250 probably null Het
Ankrd28 A T 14: 31,706,813 N920K probably damaging Het
Ankrd36 T C 11: 5,635,359 L390P probably damaging Het
Arvcf T G 16: 18,389,198 H7Q probably benign Het
Asns A G 6: 7,677,978 S367P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
C7 T A 15: 5,007,710 H562L probably benign Het
Ccdc77 T C 6: 120,350,373 D37G probably damaging Het
Cdc14a C T 3: 116,404,587 A58T probably damaging Het
Cdc42bpb C T 12: 111,336,025 probably null Het
Corin A T 5: 72,301,624 F1068L probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Ercc3 T A 18: 32,248,243 S371T probably damaging Het
Fam193a A C 5: 34,431,180 K358Q probably damaging Het
Fem1a G A 17: 56,257,522 C205Y probably benign Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gabra6 T C 11: 42,316,462 N265S probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm996 A T 2: 25,577,808 L697Q probably damaging Het
Grm6 T A 11: 50,863,082 C738S probably damaging Het
Gtsf1 C T 15: 103,428,569 probably benign Het
Hcrtr2 T A 9: 76,232,914 Y364F probably damaging Het
Ick G T 9: 78,135,645 V51F probably damaging Het
Ifit1bl1 T C 19: 34,593,936 I374V probably benign Het
Il31ra A T 13: 112,541,251 F250L probably benign Het
Iqgap1 A G 7: 80,809,059 V37A probably benign Het
Izumo3 A T 4: 92,145,023 I182K probably damaging Het
Kidins220 G A 12: 24,988,556 A36T probably damaging Het
Lrrtm1 G T 6: 77,244,253 R231L probably damaging Het
Micalcl A T 7: 112,412,976 S678C probably damaging Het
Mme T G 3: 63,364,867 F629C probably damaging Het
Muc5b T A 7: 141,857,341 H1341Q unknown Het
Olfr1339 T A 4: 118,734,902 D124E probably damaging Het
Olfr1391 A G 11: 49,328,202 S264G probably benign Het
Olfr495 A G 7: 108,396,089 H323R probably benign Het
Olfr513 A T 7: 108,755,569 T238S probably damaging Het
Olfr61 A G 7: 140,637,724 T8A possibly damaging Het
Parm1 A T 5: 91,593,865 M31L probably benign Het
Pcdhb18 G A 18: 37,489,821 C68Y probably benign Het
Pkn3 A T 2: 30,079,622 E35V probably damaging Het
Pla2g4a A T 1: 149,872,744 Y238N probably damaging Het
Pld6 T C 11: 59,787,271 D122G probably damaging Het
Prag1 G T 8: 36,103,255 A331S possibly damaging Het
Rbm44 A G 1: 91,168,829 D970G probably benign Het
Rps6kc1 A G 1: 190,773,654 V1037A probably benign Het
Slc12a7 T C 13: 73,805,469 V766A probably benign Het
Spata18 A G 5: 73,668,610 T87A Het
St3gal3 T C 4: 117,940,123 M308V probably benign Het
Stx19 T C 16: 62,822,286 L155S probably benign Het
Tespa1 A T 10: 130,356,883 T145S probably damaging Het
Timm21 A C 18: 84,947,721 F221V possibly damaging Het
Tlr1 A T 5: 64,924,921 F771Y probably damaging Het
Tmem150a C A 6: 72,358,623 L125I unknown Het
Try4 T C 6: 41,302,295 L4P possibly damaging Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Txndc16 A T 14: 45,144,960 N609K probably benign Het
Upf1 T C 8: 70,352,858 T46A probably benign Het
Zfp266 T C 9: 20,500,330 N184D probably benign Het
Zfp407 A G 18: 84,209,922 V1854A possibly damaging Het
Zfp626 T A 7: 27,818,370 C259S possibly damaging Het
Other mutations in Fh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Fh1 APN 1 175601542 missense probably damaging 1.00
IGL02637:Fh1 APN 1 175609766 missense probably benign 0.00
IGL02954:Fh1 APN 1 175609735 missense probably damaging 1.00
IGL03056:Fh1 APN 1 175606162 missense probably damaging 1.00
IGL03309:Fh1 APN 1 175604043 missense probably benign 0.01
R0729:Fh1 UTSW 1 175614817 missense probably damaging 1.00
R1240:Fh1 UTSW 1 175604015 missense probably damaging 1.00
R1327:Fh1 UTSW 1 175609744 missense probably benign 0.32
R1576:Fh1 UTSW 1 175607819 missense probably null 1.00
R1779:Fh1 UTSW 1 175601424 makesense probably null
R1823:Fh1 UTSW 1 175616548 missense probably damaging 1.00
R1851:Fh1 UTSW 1 175607886 missense probably damaging 1.00
R1943:Fh1 UTSW 1 175609778 missense probably benign
R2163:Fh1 UTSW 1 175614840 missense possibly damaging 0.80
R3766:Fh1 UTSW 1 175614750 missense probably damaging 1.00
R4193:Fh1 UTSW 1 175614841 missense possibly damaging 0.51
R4672:Fh1 UTSW 1 175604051 missense probably benign 0.07
R4812:Fh1 UTSW 1 175601459 missense probably damaging 0.99
R4849:Fh1 UTSW 1 175620506 missense probably benign 0.00
R4905:Fh1 UTSW 1 175619073 missense probably damaging 1.00
R4978:Fh1 UTSW 1 175603967 missense probably damaging 1.00
R6645:Fh1 UTSW 1 175614876 missense possibly damaging 0.94
R6681:Fh1 UTSW 1 175619124 missense probably null 0.71
R7075:Fh1 UTSW 1 175607855 missense probably benign 0.00
R7646:Fh1 UTSW 1 175614913 missense probably benign 0.03
R7862:Fh1 UTSW 1 175614834 missense probably damaging 0.97
R7945:Fh1 UTSW 1 175614834 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGTACTATTAAAAGTTGCCAACTG -3'
(R):5'- TGAAAATCCCCTGCAGAGCTC -3'

Sequencing Primer
(F):5'- GTACACAGCTCTCTGAGTTCAAGG -3'
(R):5'- GCAGAGCTCGAATGACACCTTTC -3'
Posted On2019-11-26