Incidental Mutation 'R7783:Pkn3'
ID 599355
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Name protein kinase N3
Synonyms
MMRRC Submission 045839-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7783 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 29967696-29981034 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29969634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 35 (E35V)
Ref Sequence ENSEMBL: ENSMUSP00000041025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000125346] [ENSMUST00000150770]
AlphaFold Q8K045
Predicted Effect probably damaging
Transcript: ENSMUST00000045246
AA Change: E35V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785
AA Change: E35V

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125346
AA Change: E39V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120268
Gene: ENSMUSG00000026785
AA Change: E39V

DomainStartEndE-ValueType
Hr1 19 82 3.45e-17 SMART
Hr1 102 170 6.19e-19 SMART
Hr1 175 238 6.4e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150770
AA Change: E48V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114492
Gene: ENSMUSG00000026785
AA Change: E48V

DomainStartEndE-ValueType
Hr1 28 91 3.45e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,216,875 (GRCm39) Y447* probably null Het
Abl2 T C 1: 156,386,641 (GRCm39) V8A probably benign Het
Adam33 C T 2: 130,900,257 (GRCm39) R103K unknown Het
Adamts13 G T 2: 26,880,597 (GRCm39) A727S not run Het
Ajm1 A T 2: 25,467,820 (GRCm39) L697Q probably damaging Het
Alpk2 A T 18: 65,439,325 (GRCm39) C689* probably null Het
Amt C T 9: 108,174,414 (GRCm39) Q60* probably null Het
Ankrd12 A G 17: 66,334,245 (GRCm39) probably null Het
Ankrd28 A T 14: 31,428,770 (GRCm39) N920K probably damaging Het
Ankrd36 T C 11: 5,585,359 (GRCm39) L390P probably damaging Het
Arvcf T G 16: 18,207,063 (GRCm39) H7Q probably benign Het
Asns A G 6: 7,677,978 (GRCm39) S367P probably damaging Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
C7 T A 15: 5,037,192 (GRCm39) H562L probably benign Het
Ccdc77 T C 6: 120,327,334 (GRCm39) D37G probably damaging Het
Cdc14a C T 3: 116,198,236 (GRCm39) A58T probably damaging Het
Cdc42bpb C T 12: 111,302,459 (GRCm39) probably null Het
Cilk1 G T 9: 78,042,927 (GRCm39) V51F probably damaging Het
Corin A T 5: 72,458,967 (GRCm39) F1068L probably benign Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Ercc3 T A 18: 32,381,296 (GRCm39) S371T probably damaging Het
Fam193a A C 5: 34,588,524 (GRCm39) K358Q probably damaging Het
Fem1a G A 17: 56,564,522 (GRCm39) C205Y probably benign Het
Fh1 G A 1: 175,439,744 (GRCm39) T233M probably damaging Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,143,377 (GRCm39) probably benign Het
Gabra6 T C 11: 42,207,289 (GRCm39) N265S probably damaging Het
Gm10801 C CGTG 2: 98,494,152 (GRCm39) probably null Het
Grm6 T A 11: 50,753,909 (GRCm39) C738S probably damaging Het
Gtsf1 C T 15: 103,336,996 (GRCm39) probably benign Het
Hcrtr2 T A 9: 76,140,196 (GRCm39) Y364F probably damaging Het
Ifit1bl1 T C 19: 34,571,336 (GRCm39) I374V probably benign Het
Il31ra A T 13: 112,677,785 (GRCm39) F250L probably benign Het
Iqgap1 A G 7: 80,458,807 (GRCm39) V37A probably benign Het
Izumo3 A T 4: 92,033,260 (GRCm39) I182K probably damaging Het
Kidins220 G A 12: 25,038,555 (GRCm39) A36T probably damaging Het
Lrrtm1 G T 6: 77,221,236 (GRCm39) R231L probably damaging Het
Mical2 A T 7: 112,012,183 (GRCm39) S678C probably damaging Het
Mme T G 3: 63,272,288 (GRCm39) F629C probably damaging Het
Muc5b T A 7: 141,411,078 (GRCm39) H1341Q unknown Het
Or13a28 A G 7: 140,217,637 (GRCm39) T8A possibly damaging Het
Or13p5 T A 4: 118,592,099 (GRCm39) D124E probably damaging Het
Or2y1e A G 11: 49,219,029 (GRCm39) S264G probably benign Het
Or5e1 A T 7: 108,354,776 (GRCm39) T238S probably damaging Het
Or5p70 A G 7: 107,995,296 (GRCm39) H323R probably benign Het
Parm1 A T 5: 91,741,724 (GRCm39) M31L probably benign Het
Pcdhb18 G A 18: 37,622,874 (GRCm39) C68Y probably benign Het
Pla2g4a A T 1: 149,748,495 (GRCm39) Y238N probably damaging Het
Pld6 T C 11: 59,678,097 (GRCm39) D122G probably damaging Het
Prag1 G T 8: 36,570,409 (GRCm39) A331S possibly damaging Het
Rbm44 A G 1: 91,096,551 (GRCm39) D970G probably benign Het
Rps6kc1 A G 1: 190,505,851 (GRCm39) V1037A probably benign Het
Slc12a7 T C 13: 73,953,588 (GRCm39) V766A probably benign Het
Spata18 A G 5: 73,825,953 (GRCm39) T87A Het
St3gal3 T C 4: 117,797,320 (GRCm39) M308V probably benign Het
Stx19 T C 16: 62,642,649 (GRCm39) L155S probably benign Het
Tespa1 A T 10: 130,192,752 (GRCm39) T145S probably damaging Het
Timm21 A C 18: 84,965,846 (GRCm39) F221V possibly damaging Het
Tlr1 A T 5: 65,082,264 (GRCm39) F771Y probably damaging Het
Tmem150a C A 6: 72,335,606 (GRCm39) L125I unknown Het
Try4 T C 6: 41,279,229 (GRCm39) L4P possibly damaging Het
Txlna C T 4: 129,525,950 (GRCm39) R299H probably damaging Het
Txndc16 A T 14: 45,382,417 (GRCm39) N609K probably benign Het
Upf1 T C 8: 70,805,508 (GRCm39) T46A probably benign Het
Zfp266 T C 9: 20,411,626 (GRCm39) N184D probably benign Het
Zfp407 A G 18: 84,228,047 (GRCm39) V1854A possibly damaging Het
Zfp626 T A 7: 27,517,795 (GRCm39) C259S possibly damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 29,971,116 (GRCm39) missense probably damaging 0.97
IGL00781:Pkn3 APN 2 29,973,402 (GRCm39) unclassified probably benign
IGL00815:Pkn3 APN 2 29,971,212 (GRCm39) missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 29,977,054 (GRCm39) missense probably damaging 1.00
IGL01897:Pkn3 APN 2 29,972,824 (GRCm39) unclassified probably benign
IGL02513:Pkn3 APN 2 29,973,149 (GRCm39) missense probably damaging 0.98
IGL02552:Pkn3 APN 2 29,970,879 (GRCm39) missense probably damaging 1.00
IGL02622:Pkn3 APN 2 29,973,158 (GRCm39) missense probably benign 0.28
IGL02689:Pkn3 APN 2 29,970,858 (GRCm39) missense probably damaging 1.00
IGL02996:Pkn3 APN 2 29,970,627 (GRCm39) missense probably benign 0.39
IGL03106:Pkn3 APN 2 29,975,257 (GRCm39) missense probably damaging 0.96
Enflamme UTSW 2 29,973,049 (GRCm39) unclassified probably benign
Wrath UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 29,980,539 (GRCm39) missense probably damaging 1.00
R0279:Pkn3 UTSW 2 29,973,309 (GRCm39) missense probably benign 0.16
R0370:Pkn3 UTSW 2 29,977,184 (GRCm39) missense probably damaging 1.00
R0491:Pkn3 UTSW 2 29,979,889 (GRCm39) missense probably damaging 1.00
R0600:Pkn3 UTSW 2 29,971,146 (GRCm39) missense probably benign 0.06
R1418:Pkn3 UTSW 2 29,973,059 (GRCm39) missense probably damaging 1.00
R1510:Pkn3 UTSW 2 29,969,776 (GRCm39) critical splice donor site probably null
R1535:Pkn3 UTSW 2 29,977,065 (GRCm39) missense probably benign
R1540:Pkn3 UTSW 2 29,974,703 (GRCm39) missense probably damaging 1.00
R1808:Pkn3 UTSW 2 29,969,663 (GRCm39) missense probably damaging 1.00
R1884:Pkn3 UTSW 2 29,972,840 (GRCm39) missense probably damaging 1.00
R1995:Pkn3 UTSW 2 29,979,989 (GRCm39) missense probably damaging 1.00
R3745:Pkn3 UTSW 2 29,980,353 (GRCm39) missense probably damaging 1.00
R4119:Pkn3 UTSW 2 29,973,049 (GRCm39) unclassified probably benign
R4258:Pkn3 UTSW 2 29,978,572 (GRCm39) missense probably damaging 0.99
R4665:Pkn3 UTSW 2 29,975,469 (GRCm39) unclassified probably benign
R4772:Pkn3 UTSW 2 29,974,692 (GRCm39) splice site probably null
R4808:Pkn3 UTSW 2 29,980,093 (GRCm39) missense probably damaging 1.00
R5038:Pkn3 UTSW 2 29,975,293 (GRCm39) critical splice donor site probably null
R5388:Pkn3 UTSW 2 29,971,086 (GRCm39) missense probably damaging 0.99
R5488:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R5611:Pkn3 UTSW 2 29,969,673 (GRCm39) missense probably damaging 1.00
R6001:Pkn3 UTSW 2 29,978,596 (GRCm39) critical splice donor site probably null
R6277:Pkn3 UTSW 2 29,972,957 (GRCm39) missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 29,970,699 (GRCm39) critical splice donor site probably null
R6724:Pkn3 UTSW 2 29,980,562 (GRCm39) missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 29,973,548 (GRCm39) splice site probably null
R7128:Pkn3 UTSW 2 29,973,327 (GRCm39) missense probably damaging 1.00
R7249:Pkn3 UTSW 2 29,974,773 (GRCm39) missense probably benign 0.00
R7475:Pkn3 UTSW 2 29,977,122 (GRCm39) missense probably benign 0.01
R7746:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R7747:Pkn3 UTSW 2 29,980,596 (GRCm39) missense probably benign 0.00
R8401:Pkn3 UTSW 2 29,970,071 (GRCm39) missense probably benign 0.00
R8425:Pkn3 UTSW 2 29,976,513 (GRCm39) critical splice donor site probably null
R8535:Pkn3 UTSW 2 29,969,936 (GRCm39) critical splice acceptor site probably null
R8720:Pkn3 UTSW 2 29,975,196 (GRCm39) missense probably benign 0.01
R8743:Pkn3 UTSW 2 29,973,318 (GRCm39) missense probably benign 0.00
R9415:Pkn3 UTSW 2 29,968,332 (GRCm39) missense probably benign 0.20
R9437:Pkn3 UTSW 2 29,973,267 (GRCm39) missense possibly damaging 0.93
R9583:Pkn3 UTSW 2 29,976,723 (GRCm39) missense probably null 0.99
R9800:Pkn3 UTSW 2 29,973,290 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGAGCTAGACACTGCAG -3'
(R):5'- CAAGGCCAGGATTGTGTTCG -3'

Sequencing Primer
(F):5'- CTAGACACTGCAGGGTTCTGAGAC -3'
(R):5'- GTGAGTCTCCCGTTCCCAG -3'
Posted On 2019-11-26