Incidental Mutation 'R7783:Mme'
ID599359
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Namemembrane metallo endopeptidase
SynonymsCD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7783 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location63241537-63386030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 63364867 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 629 (F629C)
Ref Sequence ENSEMBL: ENSMUSP00000029400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]
Predicted Effect probably damaging
Transcript: ENSMUST00000029400
AA Change: F629C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: F629C

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194134
AA Change: F629C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: F629C

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194150
AA Change: F629C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: F629C

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,812 Y447* probably null Het
Abl2 T C 1: 156,559,071 V8A probably benign Het
Adam33 C T 2: 131,058,337 R103K unknown Het
Adamts13 G T 2: 26,990,585 A727S not run Het
Alpk2 A T 18: 65,306,254 C689* probably null Het
Amt C T 9: 108,297,215 Q60* probably null Het
Ankrd12 A G 17: 66,027,250 probably null Het
Ankrd28 A T 14: 31,706,813 N920K probably damaging Het
Ankrd36 T C 11: 5,635,359 L390P probably damaging Het
Arvcf T G 16: 18,389,198 H7Q probably benign Het
Asns A G 6: 7,677,978 S367P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
C7 T A 15: 5,007,710 H562L probably benign Het
Ccdc77 T C 6: 120,350,373 D37G probably damaging Het
Cdc14a C T 3: 116,404,587 A58T probably damaging Het
Cdc42bpb C T 12: 111,336,025 probably null Het
Corin A T 5: 72,301,624 F1068L probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Ercc3 T A 18: 32,248,243 S371T probably damaging Het
Fam193a A C 5: 34,431,180 K358Q probably damaging Het
Fem1a G A 17: 56,257,522 C205Y probably benign Het
Fh1 G A 1: 175,612,178 T233M probably damaging Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gabra6 T C 11: 42,316,462 N265S probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm996 A T 2: 25,577,808 L697Q probably damaging Het
Grm6 T A 11: 50,863,082 C738S probably damaging Het
Gtsf1 C T 15: 103,428,569 probably benign Het
Hcrtr2 T A 9: 76,232,914 Y364F probably damaging Het
Ick G T 9: 78,135,645 V51F probably damaging Het
Ifit1bl1 T C 19: 34,593,936 I374V probably benign Het
Il31ra A T 13: 112,541,251 F250L probably benign Het
Iqgap1 A G 7: 80,809,059 V37A probably benign Het
Izumo3 A T 4: 92,145,023 I182K probably damaging Het
Kidins220 G A 12: 24,988,556 A36T probably damaging Het
Lrrtm1 G T 6: 77,244,253 R231L probably damaging Het
Micalcl A T 7: 112,412,976 S678C probably damaging Het
Muc5b T A 7: 141,857,341 H1341Q unknown Het
Olfr1339 T A 4: 118,734,902 D124E probably damaging Het
Olfr1391 A G 11: 49,328,202 S264G probably benign Het
Olfr495 A G 7: 108,396,089 H323R probably benign Het
Olfr513 A T 7: 108,755,569 T238S probably damaging Het
Olfr61 A G 7: 140,637,724 T8A possibly damaging Het
Parm1 A T 5: 91,593,865 M31L probably benign Het
Pcdhb18 G A 18: 37,489,821 C68Y probably benign Het
Pkn3 A T 2: 30,079,622 E35V probably damaging Het
Pla2g4a A T 1: 149,872,744 Y238N probably damaging Het
Pld6 T C 11: 59,787,271 D122G probably damaging Het
Prag1 G T 8: 36,103,255 A331S possibly damaging Het
Rbm44 A G 1: 91,168,829 D970G probably benign Het
Rps6kc1 A G 1: 190,773,654 V1037A probably benign Het
Slc12a7 T C 13: 73,805,469 V766A probably benign Het
Spata18 A G 5: 73,668,610 T87A Het
St3gal3 T C 4: 117,940,123 M308V probably benign Het
Stx19 T C 16: 62,822,286 L155S probably benign Het
Tespa1 A T 10: 130,356,883 T145S probably damaging Het
Timm21 A C 18: 84,947,721 F221V possibly damaging Het
Tlr1 A T 5: 64,924,921 F771Y probably damaging Het
Tmem150a C A 6: 72,358,623 L125I unknown Het
Try4 T C 6: 41,302,295 L4P possibly damaging Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Txndc16 A T 14: 45,144,960 N609K probably benign Het
Upf1 T C 8: 70,352,858 T46A probably benign Het
Zfp266 T C 9: 20,500,330 N184D probably benign Het
Zfp407 A G 18: 84,209,922 V1854A possibly damaging Het
Zfp626 T A 7: 27,818,370 C259S possibly damaging Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 unclassified probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63327983 missense probably benign 0.31
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2306:Mme UTSW 3 63300252 missense probably benign 0.00
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4706:Mme UTSW 3 63348712 missense possibly damaging 0.92
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6711:Mme UTSW 3 63341918 missense possibly damaging 0.93
R6842:Mme UTSW 3 63362044 missense probably damaging 1.00
R6996:Mme UTSW 3 63346102 missense possibly damaging 0.63
R7040:Mme UTSW 3 63368923 missense probably damaging 1.00
R7043:Mme UTSW 3 63345217 nonsense probably null
R7084:Mme UTSW 3 63328217 missense probably damaging 0.98
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTGAAACAGTAAGTTGTACG -3'
(R):5'- GGCCAATACCTCCATTATCAGC -3'

Sequencing Primer
(F):5'- GAAACAGTAAGTTGTACGTTGTTTG -3'
(R):5'- TTATCAGCAATGTTTTCTCCTAGTG -3'
Posted On2019-11-26