Incidental Mutation 'R7783:Corin'
ID599367
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Namecorin
SynonymsLrp4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7783 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location72300025-72504473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72301624 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1068 (F1068L)
Ref Sequence ENSEMBL: ENSMUSP00000005352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000094710] [ENSMUST00000126664] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
Predicted Effect probably benign
Transcript: ENSMUST00000005352
AA Change: F1068L

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: F1068L

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094710
SMART Domains Protein: ENSMUSP00000142749
Gene: ENSMUSG00000046808

DomainStartEndE-ValueType
SCOP:d1eula_ 5 180 9e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126664
SMART Domains Protein: ENSMUSP00000143594
Gene: ENSMUSG00000046808

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 111 176 1.2e-21 PFAM
Pfam:E1-E2_ATPase 181 450 3e-10 PFAM
low complexity region 523 534 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Pfam:Cation_ATPase 739 859 3.4e-7 PFAM
Pfam:HAD 754 1114 1.3e-12 PFAM
Pfam:PhoLip_ATPase_C 1131 1376 4.3e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167460
AA Change: F1002L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: F1002L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175766
AA Change: F927L

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: F927L

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176974
AA Change: F965L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: F965L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177290
AA Change: F935L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: F935L

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,812 Y447* probably null Het
Abl2 T C 1: 156,559,071 V8A probably benign Het
Adam33 C T 2: 131,058,337 R103K unknown Het
Adamts13 G T 2: 26,990,585 A727S not run Het
Alpk2 A T 18: 65,306,254 C689* probably null Het
Amt C T 9: 108,297,215 Q60* probably null Het
Ankrd12 A G 17: 66,027,250 probably null Het
Ankrd28 A T 14: 31,706,813 N920K probably damaging Het
Ankrd36 T C 11: 5,635,359 L390P probably damaging Het
Arvcf T G 16: 18,389,198 H7Q probably benign Het
Asns A G 6: 7,677,978 S367P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
C7 T A 15: 5,007,710 H562L probably benign Het
Ccdc77 T C 6: 120,350,373 D37G probably damaging Het
Cdc14a C T 3: 116,404,587 A58T probably damaging Het
Cdc42bpb C T 12: 111,336,025 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Ercc3 T A 18: 32,248,243 S371T probably damaging Het
Fam193a A C 5: 34,431,180 K358Q probably damaging Het
Fem1a G A 17: 56,257,522 C205Y probably benign Het
Fh1 G A 1: 175,612,178 T233M probably damaging Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gabra6 T C 11: 42,316,462 N265S probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm996 A T 2: 25,577,808 L697Q probably damaging Het
Grm6 T A 11: 50,863,082 C738S probably damaging Het
Gtsf1 C T 15: 103,428,569 probably benign Het
Hcrtr2 T A 9: 76,232,914 Y364F probably damaging Het
Ick G T 9: 78,135,645 V51F probably damaging Het
Ifit1bl1 T C 19: 34,593,936 I374V probably benign Het
Il31ra A T 13: 112,541,251 F250L probably benign Het
Iqgap1 A G 7: 80,809,059 V37A probably benign Het
Izumo3 A T 4: 92,145,023 I182K probably damaging Het
Kidins220 G A 12: 24,988,556 A36T probably damaging Het
Lrrtm1 G T 6: 77,244,253 R231L probably damaging Het
Micalcl A T 7: 112,412,976 S678C probably damaging Het
Mme T G 3: 63,364,867 F629C probably damaging Het
Muc5b T A 7: 141,857,341 H1341Q unknown Het
Olfr1339 T A 4: 118,734,902 D124E probably damaging Het
Olfr1391 A G 11: 49,328,202 S264G probably benign Het
Olfr495 A G 7: 108,396,089 H323R probably benign Het
Olfr513 A T 7: 108,755,569 T238S probably damaging Het
Olfr61 A G 7: 140,637,724 T8A possibly damaging Het
Parm1 A T 5: 91,593,865 M31L probably benign Het
Pcdhb18 G A 18: 37,489,821 C68Y probably benign Het
Pkn3 A T 2: 30,079,622 E35V probably damaging Het
Pla2g4a A T 1: 149,872,744 Y238N probably damaging Het
Pld6 T C 11: 59,787,271 D122G probably damaging Het
Prag1 G T 8: 36,103,255 A331S possibly damaging Het
Rbm44 A G 1: 91,168,829 D970G probably benign Het
Rps6kc1 A G 1: 190,773,654 V1037A probably benign Het
Slc12a7 T C 13: 73,805,469 V766A probably benign Het
Spata18 A G 5: 73,668,610 T87A Het
St3gal3 T C 4: 117,940,123 M308V probably benign Het
Stx19 T C 16: 62,822,286 L155S probably benign Het
Tespa1 A T 10: 130,356,883 T145S probably damaging Het
Timm21 A C 18: 84,947,721 F221V possibly damaging Het
Tlr1 A T 5: 64,924,921 F771Y probably damaging Het
Tmem150a C A 6: 72,358,623 L125I unknown Het
Try4 T C 6: 41,302,295 L4P possibly damaging Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Txndc16 A T 14: 45,144,960 N609K probably benign Het
Upf1 T C 8: 70,352,858 T46A probably benign Het
Zfp266 T C 9: 20,500,330 N184D probably benign Het
Zfp407 A G 18: 84,209,922 V1854A possibly damaging Het
Zfp626 T A 7: 27,818,370 C259S possibly damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2173:Corin UTSW 5 72504079 missense probably benign 0.01
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3939:Corin UTSW 5 72339879 missense possibly damaging 0.80
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4849:Corin UTSW 5 72302835 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5268:Corin UTSW 5 72343019 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5352:Corin UTSW 5 72305033 missense probably benign 0.04
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
R7242:Corin UTSW 5 72305055 missense probably benign 0.14
R7452:Corin UTSW 5 72435247 missense possibly damaging 0.94
R7903:Corin UTSW 5 72301500 missense probably benign 0.00
R7986:Corin UTSW 5 72301500 missense probably benign 0.00
R8007:Corin UTSW 5 72316103 missense probably damaging 0.96
Z1177:Corin UTSW 5 72454493 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGTCATTCTCCATGTAGGTTTC -3'
(R):5'- TACAGTGGAACGCAGATGCC -3'

Sequencing Primer
(F):5'- ATGTAGGTTTCCCCACAAAGTC -3'
(R):5'- CCCAGGCTTACTATGAAAAACTTTGC -3'
Posted On2019-11-26