Incidental Mutation 'R7783:Tespa1'
ID599389
Institutional Source Beutler Lab
Gene Symbol Tespa1
Ensembl Gene ENSMUSG00000034833
Gene Namethymocyte expressed, positive selection associated 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7783 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location130322870-130364111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130356883 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 145 (T145S)
Ref Sequence ENSEMBL: ENSMUSP00000047284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042586] [ENSMUST00000217702]
Predicted Effect probably damaging
Transcript: ENSMUST00000042586
AA Change: T145S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047284
Gene: ENSMUSG00000034833
AA Change: T145S

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
KRAP_IP3R_bind 128 292 2.24e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217702
AA Change: T145S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired late thymocyte development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,812 Y447* probably null Het
Abl2 T C 1: 156,559,071 V8A probably benign Het
Adam33 C T 2: 131,058,337 R103K unknown Het
Adamts13 G T 2: 26,990,585 A727S not run Het
Alpk2 A T 18: 65,306,254 C689* probably null Het
Amt C T 9: 108,297,215 Q60* probably null Het
Ankrd12 A G 17: 66,027,250 probably null Het
Ankrd28 A T 14: 31,706,813 N920K probably damaging Het
Ankrd36 T C 11: 5,635,359 L390P probably damaging Het
Arvcf T G 16: 18,389,198 H7Q probably benign Het
Asns A G 6: 7,677,978 S367P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
C7 T A 15: 5,007,710 H562L probably benign Het
Ccdc77 T C 6: 120,350,373 D37G probably damaging Het
Cdc14a C T 3: 116,404,587 A58T probably damaging Het
Cdc42bpb C T 12: 111,336,025 probably null Het
Corin A T 5: 72,301,624 F1068L probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Ercc3 T A 18: 32,248,243 S371T probably damaging Het
Fam193a A C 5: 34,431,180 K358Q probably damaging Het
Fem1a G A 17: 56,257,522 C205Y probably benign Het
Fh1 G A 1: 175,612,178 T233M probably damaging Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gabra6 T C 11: 42,316,462 N265S probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm996 A T 2: 25,577,808 L697Q probably damaging Het
Grm6 T A 11: 50,863,082 C738S probably damaging Het
Gtsf1 C T 15: 103,428,569 probably benign Het
Hcrtr2 T A 9: 76,232,914 Y364F probably damaging Het
Ick G T 9: 78,135,645 V51F probably damaging Het
Ifit1bl1 T C 19: 34,593,936 I374V probably benign Het
Il31ra A T 13: 112,541,251 F250L probably benign Het
Iqgap1 A G 7: 80,809,059 V37A probably benign Het
Izumo3 A T 4: 92,145,023 I182K probably damaging Het
Kidins220 G A 12: 24,988,556 A36T probably damaging Het
Lrrtm1 G T 6: 77,244,253 R231L probably damaging Het
Micalcl A T 7: 112,412,976 S678C probably damaging Het
Mme T G 3: 63,364,867 F629C probably damaging Het
Muc5b T A 7: 141,857,341 H1341Q unknown Het
Olfr1339 T A 4: 118,734,902 D124E probably damaging Het
Olfr1391 A G 11: 49,328,202 S264G probably benign Het
Olfr495 A G 7: 108,396,089 H323R probably benign Het
Olfr513 A T 7: 108,755,569 T238S probably damaging Het
Olfr61 A G 7: 140,637,724 T8A possibly damaging Het
Parm1 A T 5: 91,593,865 M31L probably benign Het
Pcdhb18 G A 18: 37,489,821 C68Y probably benign Het
Pkn3 A T 2: 30,079,622 E35V probably damaging Het
Pla2g4a A T 1: 149,872,744 Y238N probably damaging Het
Pld6 T C 11: 59,787,271 D122G probably damaging Het
Prag1 G T 8: 36,103,255 A331S possibly damaging Het
Rbm44 A G 1: 91,168,829 D970G probably benign Het
Rps6kc1 A G 1: 190,773,654 V1037A probably benign Het
Slc12a7 T C 13: 73,805,469 V766A probably benign Het
Spata18 A G 5: 73,668,610 T87A Het
St3gal3 T C 4: 117,940,123 M308V probably benign Het
Stx19 T C 16: 62,822,286 L155S probably benign Het
Timm21 A C 18: 84,947,721 F221V possibly damaging Het
Tlr1 A T 5: 64,924,921 F771Y probably damaging Het
Tmem150a C A 6: 72,358,623 L125I unknown Het
Try4 T C 6: 41,302,295 L4P possibly damaging Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Txndc16 A T 14: 45,144,960 N609K probably benign Het
Upf1 T C 8: 70,352,858 T46A probably benign Het
Zfp266 T C 9: 20,500,330 N184D probably benign Het
Zfp407 A G 18: 84,209,922 V1854A possibly damaging Het
Zfp626 T A 7: 27,818,370 C259S possibly damaging Het
Other mutations in Tespa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Tespa1 APN 10 130355484 missense probably damaging 1.00
R0081:Tespa1 UTSW 10 130360850 missense probably damaging 1.00
R0544:Tespa1 UTSW 10 130360811 missense probably damaging 1.00
R1381:Tespa1 UTSW 10 130360691 missense probably benign 0.45
R1781:Tespa1 UTSW 10 130348250 missense probably benign 0.37
R1912:Tespa1 UTSW 10 130354723 missense probably benign 0.37
R1927:Tespa1 UTSW 10 130348239 missense probably benign 0.00
R2428:Tespa1 UTSW 10 130362075 missense probably damaging 0.99
R3907:Tespa1 UTSW 10 130356797 splice site probably benign
R4439:Tespa1 UTSW 10 130361957 missense probably damaging 1.00
R4440:Tespa1 UTSW 10 130361957 missense probably damaging 1.00
R4441:Tespa1 UTSW 10 130361957 missense probably damaging 1.00
R4836:Tespa1 UTSW 10 130362159 missense probably benign 0.00
R5045:Tespa1 UTSW 10 130362035 nonsense probably null
R5566:Tespa1 UTSW 10 130355487 nonsense probably null
R5670:Tespa1 UTSW 10 130354755 missense probably damaging 0.96
R5691:Tespa1 UTSW 10 130354769 critical splice donor site probably null
R6173:Tespa1 UTSW 10 130347303 missense probably benign 0.08
R7325:Tespa1 UTSW 10 130362041 missense probably damaging 1.00
R7455:Tespa1 UTSW 10 130360690 missense probably benign 0.00
R7577:Tespa1 UTSW 10 130354755 missense probably damaging 0.96
R8048:Tespa1 UTSW 10 130347339 missense probably damaging 1.00
Z1176:Tespa1 UTSW 10 130361895 missense probably damaging 0.99
Z1177:Tespa1 UTSW 10 130362430 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTCCTCAGCACAGGGAAAATAC -3'
(R):5'- CTCCTGTATAGGTTCAGTGGAAGG -3'

Sequencing Primer
(F):5'- CATTCAGTAGGGGGAGCTTAAGGTC -3'
(R):5'- ATAGGTTCAGTGGAAGGATGCTCC -3'
Posted On2019-11-26