Incidental Mutation 'R7783:Ankrd36'
ID599390
Institutional Source Beutler Lab
Gene Symbol Ankrd36
Ensembl Gene ENSMUSG00000020481
Gene Nameankyrin repeat domain 36
Synonyms1700012M14Rik, 1700008J08Rik, GC3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7783 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location5569684-5689337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5635359 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 390 (L390P)
Ref Sequence ENSEMBL: ENSMUSP00000120499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109856] [ENSMUST00000118112] [ENSMUST00000137933]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109856
AA Change: L1032P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105482
Gene: ENSMUSG00000020481
AA Change: L1032P

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 4.5e-3 SMART
ANK 99 128 1.44e-1 SMART
ANK 132 161 4.6e0 SMART
ANK 165 194 2.48e-5 SMART
ANK 198 227 4.67e-1 SMART
internal_repeat_1 449 555 1.04e-5 PROSPERO
internal_repeat_1 891 981 1.04e-5 PROSPERO
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1268 1297 N/A INTRINSIC
coiled coil region 1318 1338 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118112
AA Change: L1065P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122397
Gene: ENSMUSG00000020481
AA Change: L1065P

DomainStartEndE-ValueType
Blast:ANK 29 62 3e-12 BLAST
ANK 66 95 2.9e-5 SMART
ANK 99 128 9.4e-4 SMART
ANK 132 161 2.9e-2 SMART
ANK 165 194 1.5e-7 SMART
ANK 198 227 2.9e-3 SMART
internal_repeat_1 255 352 8.15e-5 PROSPERO
internal_repeat_1 438 538 8.15e-5 PROSPERO
low complexity region 1138 1151 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137933
AA Change: L390P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120499
Gene: ENSMUSG00000020481
AA Change: L390P

DomainStartEndE-ValueType
low complexity region 463 476 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,812 Y447* probably null Het
Abl2 T C 1: 156,559,071 V8A probably benign Het
Adam33 C T 2: 131,058,337 R103K unknown Het
Adamts13 G T 2: 26,990,585 A727S not run Het
Alpk2 A T 18: 65,306,254 C689* probably null Het
Amt C T 9: 108,297,215 Q60* probably null Het
Ankrd12 A G 17: 66,027,250 probably null Het
Ankrd28 A T 14: 31,706,813 N920K probably damaging Het
Arvcf T G 16: 18,389,198 H7Q probably benign Het
Asns A G 6: 7,677,978 S367P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
C7 T A 15: 5,007,710 H562L probably benign Het
Ccdc77 T C 6: 120,350,373 D37G probably damaging Het
Cdc14a C T 3: 116,404,587 A58T probably damaging Het
Cdc42bpb C T 12: 111,336,025 probably null Het
Corin A T 5: 72,301,624 F1068L probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Ercc3 T A 18: 32,248,243 S371T probably damaging Het
Fam193a A C 5: 34,431,180 K358Q probably damaging Het
Fem1a G A 17: 56,257,522 C205Y probably benign Het
Fh1 G A 1: 175,612,178 T233M probably damaging Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gabra6 T C 11: 42,316,462 N265S probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm996 A T 2: 25,577,808 L697Q probably damaging Het
Grm6 T A 11: 50,863,082 C738S probably damaging Het
Gtsf1 C T 15: 103,428,569 probably benign Het
Hcrtr2 T A 9: 76,232,914 Y364F probably damaging Het
Ick G T 9: 78,135,645 V51F probably damaging Het
Ifit1bl1 T C 19: 34,593,936 I374V probably benign Het
Il31ra A T 13: 112,541,251 F250L probably benign Het
Iqgap1 A G 7: 80,809,059 V37A probably benign Het
Izumo3 A T 4: 92,145,023 I182K probably damaging Het
Kidins220 G A 12: 24,988,556 A36T probably damaging Het
Lrrtm1 G T 6: 77,244,253 R231L probably damaging Het
Micalcl A T 7: 112,412,976 S678C probably damaging Het
Mme T G 3: 63,364,867 F629C probably damaging Het
Muc5b T A 7: 141,857,341 H1341Q unknown Het
Olfr1339 T A 4: 118,734,902 D124E probably damaging Het
Olfr1391 A G 11: 49,328,202 S264G probably benign Het
Olfr495 A G 7: 108,396,089 H323R probably benign Het
Olfr513 A T 7: 108,755,569 T238S probably damaging Het
Olfr61 A G 7: 140,637,724 T8A possibly damaging Het
Parm1 A T 5: 91,593,865 M31L probably benign Het
Pcdhb18 G A 18: 37,489,821 C68Y probably benign Het
Pkn3 A T 2: 30,079,622 E35V probably damaging Het
Pla2g4a A T 1: 149,872,744 Y238N probably damaging Het
Pld6 T C 11: 59,787,271 D122G probably damaging Het
Prag1 G T 8: 36,103,255 A331S possibly damaging Het
Rbm44 A G 1: 91,168,829 D970G probably benign Het
Rps6kc1 A G 1: 190,773,654 V1037A probably benign Het
Slc12a7 T C 13: 73,805,469 V766A probably benign Het
Spata18 A G 5: 73,668,610 T87A Het
St3gal3 T C 4: 117,940,123 M308V probably benign Het
Stx19 T C 16: 62,822,286 L155S probably benign Het
Tespa1 A T 10: 130,356,883 T145S probably damaging Het
Timm21 A C 18: 84,947,721 F221V possibly damaging Het
Tlr1 A T 5: 64,924,921 F771Y probably damaging Het
Tmem150a C A 6: 72,358,623 L125I unknown Het
Try4 T C 6: 41,302,295 L4P possibly damaging Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Txndc16 A T 14: 45,144,960 N609K probably benign Het
Upf1 T C 8: 70,352,858 T46A probably benign Het
Zfp266 T C 9: 20,500,330 N184D probably benign Het
Zfp407 A G 18: 84,209,922 V1854A possibly damaging Het
Zfp626 T A 7: 27,818,370 C259S possibly damaging Het
Other mutations in Ankrd36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ankrd36 APN 11 5620131 missense probably benign 0.01
IGL01361:Ankrd36 APN 11 5596706 splice site probably benign
IGL01370:Ankrd36 APN 11 5584019 missense probably benign 0.06
IGL01384:Ankrd36 APN 11 5628348 missense probably benign 0.33
IGL01484:Ankrd36 APN 11 5629006 missense possibly damaging 0.90
IGL01524:Ankrd36 APN 11 5635092 missense probably benign
IGL01700:Ankrd36 APN 11 5632198 missense probably benign 0.05
IGL02322:Ankrd36 APN 11 5614619 missense possibly damaging 0.86
IGL02511:Ankrd36 APN 11 5660845 unclassified probably null
IGL02824:Ankrd36 APN 11 5574246 missense possibly damaging 0.67
IGL03204:Ankrd36 APN 11 5584023 missense possibly damaging 0.70
PIT4508001:Ankrd36 UTSW 11 5607137 missense possibly damaging 0.53
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0058:Ankrd36 UTSW 11 5630691 splice site probably benign
R0304:Ankrd36 UTSW 11 5628981 missense possibly damaging 0.55
R0504:Ankrd36 UTSW 11 5629274 missense probably damaging 0.99
R0550:Ankrd36 UTSW 11 5607429 critical splice donor site probably null
R0563:Ankrd36 UTSW 11 5629322 missense probably benign 0.33
R0891:Ankrd36 UTSW 11 5687316 missense possibly damaging 0.72
R1018:Ankrd36 UTSW 11 5646876 unclassified probably benign
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1468:Ankrd36 UTSW 11 5575752 missense probably damaging 0.99
R1558:Ankrd36 UTSW 11 5635329 missense probably damaging 0.99
R1663:Ankrd36 UTSW 11 5620126 missense possibly damaging 0.70
R1682:Ankrd36 UTSW 11 5607143 missense possibly damaging 0.84
R1898:Ankrd36 UTSW 11 5575683 missense probably benign 0.33
R2019:Ankrd36 UTSW 11 5689140 missense probably benign
R2032:Ankrd36 UTSW 11 5628616 missense possibly damaging 0.86
R2084:Ankrd36 UTSW 11 5662378 nonsense probably null
R4097:Ankrd36 UTSW 11 5628703 missense possibly damaging 0.85
R4572:Ankrd36 UTSW 11 5689340 unclassified probably null
R4601:Ankrd36 UTSW 11 5570102 missense probably benign 0.04
R4770:Ankrd36 UTSW 11 5590870 missense possibly damaging 0.73
R4777:Ankrd36 UTSW 11 5607120 missense probably benign
R4894:Ankrd36 UTSW 11 5635332 missense probably damaging 0.98
R5288:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5366:Ankrd36 UTSW 11 5592841 nonsense probably null
R5384:Ankrd36 UTSW 11 5689340 unclassified probably benign
R5385:Ankrd36 UTSW 11 5689340 unclassified probably benign
R6109:Ankrd36 UTSW 11 5628941 missense probably damaging 0.98
R6155:Ankrd36 UTSW 11 5687442 missense probably benign 0.00
R6186:Ankrd36 UTSW 11 5643812 missense possibly damaging 0.81
R6289:Ankrd36 UTSW 11 5628837 missense probably damaging 0.96
R6476:Ankrd36 UTSW 11 5628753 missense probably benign 0.05
R6816:Ankrd36 UTSW 11 5643765 missense possibly damaging 0.66
R6880:Ankrd36 UTSW 11 5628748 missense probably damaging 0.99
R6919:Ankrd36 UTSW 11 5629299 missense probably benign
R7007:Ankrd36 UTSW 11 5689168 missense probably benign 0.00
R7515:Ankrd36 UTSW 11 5628905 missense possibly damaging 0.94
R7617:Ankrd36 UTSW 11 5687348 missense probably benign 0.33
R7684:Ankrd36 UTSW 11 5570113 missense possibly damaging 0.49
R7746:Ankrd36 UTSW 11 5687451 missense possibly damaging 0.96
R7790:Ankrd36 UTSW 11 5635176 missense possibly damaging 0.80
RF004:Ankrd36 UTSW 11 5662411 missense possibly damaging 0.53
U24488:Ankrd36 UTSW 11 5630772 missense probably damaging 0.99
Z1176:Ankrd36 UTSW 11 5615538 missense probably benign
Z1177:Ankrd36 UTSW 11 5571117 missense probably damaging 0.97
Z1177:Ankrd36 UTSW 11 5629345 missense probably benign 0.01
Z1177:Ankrd36 UTSW 11 5643738 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAAGAATGTGCACCAGGAC -3'
(R):5'- GCATGCTACGTCCTTACACG -3'

Sequencing Primer
(F):5'- GGACATCCAGAAGTTCCTTCAGTG -3'
(R):5'- GCTAAGCTCGTGTTCAGACCAAG -3'
Posted On2019-11-26