Incidental Mutation 'R7783:Olfr1391'
ID599392
Institutional Source Beutler Lab
Gene Symbol Olfr1391
Ensembl Gene ENSMUSG00000101874
Gene Nameolfactory receptor 1391
SynonymsGA_x6K02T2QP88-6107233-6106298, MOR256-27
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7783 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49322742-49329810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49328202 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 264 (S264G)
Ref Sequence ENSEMBL: ENSMUSP00000150635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187509] [ENSMUST00000215671]
Predicted Effect probably benign
Transcript: ENSMUST00000187509
AA Change: S264G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140343
Gene: ENSMUSG00000101874
AA Change: S264G

DomainStartEndE-ValueType
Pfam:7tm_1 41 289 2.2e-29 PFAM
Pfam:7tm_4 139 282 6.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215671
AA Change: S264G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,812 Y447* probably null Het
Abl2 T C 1: 156,559,071 V8A probably benign Het
Adam33 C T 2: 131,058,337 R103K unknown Het
Adamts13 G T 2: 26,990,585 A727S not run Het
Alpk2 A T 18: 65,306,254 C689* probably null Het
Amt C T 9: 108,297,215 Q60* probably null Het
Ankrd12 A G 17: 66,027,250 probably null Het
Ankrd28 A T 14: 31,706,813 N920K probably damaging Het
Ankrd36 T C 11: 5,635,359 L390P probably damaging Het
Arvcf T G 16: 18,389,198 H7Q probably benign Het
Asns A G 6: 7,677,978 S367P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
C7 T A 15: 5,007,710 H562L probably benign Het
Ccdc77 T C 6: 120,350,373 D37G probably damaging Het
Cdc14a C T 3: 116,404,587 A58T probably damaging Het
Cdc42bpb C T 12: 111,336,025 probably null Het
Corin A T 5: 72,301,624 F1068L probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Ercc3 T A 18: 32,248,243 S371T probably damaging Het
Fam193a A C 5: 34,431,180 K358Q probably damaging Het
Fem1a G A 17: 56,257,522 C205Y probably benign Het
Fh1 G A 1: 175,612,178 T233M probably damaging Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gabra6 T C 11: 42,316,462 N265S probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm996 A T 2: 25,577,808 L697Q probably damaging Het
Grm6 T A 11: 50,863,082 C738S probably damaging Het
Gtsf1 C T 15: 103,428,569 probably benign Het
Hcrtr2 T A 9: 76,232,914 Y364F probably damaging Het
Ick G T 9: 78,135,645 V51F probably damaging Het
Ifit1bl1 T C 19: 34,593,936 I374V probably benign Het
Il31ra A T 13: 112,541,251 F250L probably benign Het
Iqgap1 A G 7: 80,809,059 V37A probably benign Het
Izumo3 A T 4: 92,145,023 I182K probably damaging Het
Kidins220 G A 12: 24,988,556 A36T probably damaging Het
Lrrtm1 G T 6: 77,244,253 R231L probably damaging Het
Micalcl A T 7: 112,412,976 S678C probably damaging Het
Mme T G 3: 63,364,867 F629C probably damaging Het
Muc5b T A 7: 141,857,341 H1341Q unknown Het
Olfr1339 T A 4: 118,734,902 D124E probably damaging Het
Olfr495 A G 7: 108,396,089 H323R probably benign Het
Olfr513 A T 7: 108,755,569 T238S probably damaging Het
Olfr61 A G 7: 140,637,724 T8A possibly damaging Het
Parm1 A T 5: 91,593,865 M31L probably benign Het
Pcdhb18 G A 18: 37,489,821 C68Y probably benign Het
Pkn3 A T 2: 30,079,622 E35V probably damaging Het
Pla2g4a A T 1: 149,872,744 Y238N probably damaging Het
Pld6 T C 11: 59,787,271 D122G probably damaging Het
Prag1 G T 8: 36,103,255 A331S possibly damaging Het
Rbm44 A G 1: 91,168,829 D970G probably benign Het
Rps6kc1 A G 1: 190,773,654 V1037A probably benign Het
Slc12a7 T C 13: 73,805,469 V766A probably benign Het
Spata18 A G 5: 73,668,610 T87A Het
St3gal3 T C 4: 117,940,123 M308V probably benign Het
Stx19 T C 16: 62,822,286 L155S probably benign Het
Tespa1 A T 10: 130,356,883 T145S probably damaging Het
Timm21 A C 18: 84,947,721 F221V possibly damaging Het
Tlr1 A T 5: 64,924,921 F771Y probably damaging Het
Tmem150a C A 6: 72,358,623 L125I unknown Het
Try4 T C 6: 41,302,295 L4P possibly damaging Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Txndc16 A T 14: 45,144,960 N609K probably benign Het
Upf1 T C 8: 70,352,858 T46A probably benign Het
Zfp266 T C 9: 20,500,330 N184D probably benign Het
Zfp407 A G 18: 84,209,922 V1854A possibly damaging Het
Zfp626 T A 7: 27,818,370 C259S possibly damaging Het
Other mutations in Olfr1391
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Olfr1391 APN 11 49328131 missense probably damaging 1.00
IGL02171:Olfr1391 APN 11 49328035 missense possibly damaging 0.69
IGL03184:Olfr1391 APN 11 49327741 missense probably damaging 0.97
R0471:Olfr1391 UTSW 11 49327917 missense probably damaging 1.00
R0613:Olfr1391 UTSW 11 49327748 missense possibly damaging 0.81
R0616:Olfr1391 UTSW 11 49327756 missense probably damaging 1.00
R0825:Olfr1391 UTSW 11 49327682 missense probably benign 0.00
R1613:Olfr1391 UTSW 11 49327693 missense probably damaging 1.00
R3429:Olfr1391 UTSW 11 49328041 missense probably benign 0.00
R3727:Olfr1391 UTSW 11 49327795 missense probably benign 0.01
R4256:Olfr1391 UTSW 11 49327477 missense probably benign 0.20
R4459:Olfr1391 UTSW 11 49327876 missense probably damaging 1.00
R4552:Olfr1391 UTSW 11 49327950 missense probably benign 0.00
R4811:Olfr1391 UTSW 11 49327748 missense possibly damaging 0.81
R4881:Olfr1391 UTSW 11 49328297 missense probably benign 0.43
R5838:Olfr1391 UTSW 11 49327933 missense probably damaging 0.99
R6804:Olfr1391 UTSW 11 49327981 missense probably benign 0.16
R6809:Olfr1391 UTSW 11 49327860 missense probably benign 0.00
R7763:Olfr1391 UTSW 11 49327671 missense probably benign 0.00
R7765:Olfr1391 UTSW 11 49327744 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTATTCCCAGCAACATTGATTC -3'
(R):5'- TGGGCTCAATTCTCCTGAAGC -3'

Sequencing Primer
(F):5'- TCCCAGCAACATTGATTCTAGGATCG -3'
(R):5'- GCTCAATTCTCCTGAAGCTATTACAG -3'
Posted On2019-11-26