Incidental Mutation 'R7783:Ankrd28'
ID599401
Institutional Source Beutler Lab
Gene Symbol Ankrd28
Ensembl Gene ENSMUSG00000014496
Gene Nameankyrin repeat domain 28
SynonymsE430019N21Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R7783 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location31698768-31830651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31706813 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 920 (N920K)
Ref Sequence ENSEMBL: ENSMUSP00000014640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014640] [ENSMUST00000227089] [ENSMUST00000227863]
Predicted Effect probably damaging
Transcript: ENSMUST00000014640
AA Change: N920K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000014640
Gene: ENSMUSG00000014496
AA Change: N920K

DomainStartEndE-ValueType
ANK 7 36 5.69e2 SMART
ANK 40 69 2.45e-4 SMART
ANK 73 102 1.59e-3 SMART
ANK 106 135 1.09e-1 SMART
ANK 139 168 1.58e-7 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.01e-5 SMART
ANK 238 267 2.74e-7 SMART
ANK 271 301 4.13e-2 SMART
ANK 305 334 3.8e-1 SMART
ANK 338 367 3.06e-5 SMART
ANK 371 400 1.44e-1 SMART
ANK 404 433 6.76e-7 SMART
ANK 437 466 1.73e-4 SMART
ANK 470 500 7.83e-3 SMART
ANK 504 534 2.99e1 SMART
ANK 549 578 1.34e-1 SMART
ANK 582 611 3.76e-5 SMART
ANK 616 645 4.13e-2 SMART
ANK 652 681 1.24e-5 SMART
ANK 685 714 4.5e-3 SMART
ANK 718 747 1.93e-2 SMART
ANK 755 784 2.85e-5 SMART
ANK 787 818 2.15e0 SMART
ANK 822 851 2.16e-5 SMART
ANK 855 885 4.5e-3 SMART
ANK 889 918 6.61e-1 SMART
ANK 925 954 3.85e-2 SMART
low complexity region 982 995 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227089
AA Change: N766K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000227863
AA Change: N950K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,812 Y447* probably null Het
Abl2 T C 1: 156,559,071 V8A probably benign Het
Adam33 C T 2: 131,058,337 R103K unknown Het
Adamts13 G T 2: 26,990,585 A727S not run Het
Alpk2 A T 18: 65,306,254 C689* probably null Het
Amt C T 9: 108,297,215 Q60* probably null Het
Ankrd12 A G 17: 66,027,250 probably null Het
Ankrd36 T C 11: 5,635,359 L390P probably damaging Het
Arvcf T G 16: 18,389,198 H7Q probably benign Het
Asns A G 6: 7,677,978 S367P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
C7 T A 15: 5,007,710 H562L probably benign Het
Ccdc77 T C 6: 120,350,373 D37G probably damaging Het
Cdc14a C T 3: 116,404,587 A58T probably damaging Het
Cdc42bpb C T 12: 111,336,025 probably null Het
Corin A T 5: 72,301,624 F1068L probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Ercc3 T A 18: 32,248,243 S371T probably damaging Het
Fam193a A C 5: 34,431,180 K358Q probably damaging Het
Fem1a G A 17: 56,257,522 C205Y probably benign Het
Fh1 G A 1: 175,612,178 T233M probably damaging Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gabra6 T C 11: 42,316,462 N265S probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm996 A T 2: 25,577,808 L697Q probably damaging Het
Grm6 T A 11: 50,863,082 C738S probably damaging Het
Gtsf1 C T 15: 103,428,569 probably benign Het
Hcrtr2 T A 9: 76,232,914 Y364F probably damaging Het
Ick G T 9: 78,135,645 V51F probably damaging Het
Ifit1bl1 T C 19: 34,593,936 I374V probably benign Het
Il31ra A T 13: 112,541,251 F250L probably benign Het
Iqgap1 A G 7: 80,809,059 V37A probably benign Het
Izumo3 A T 4: 92,145,023 I182K probably damaging Het
Kidins220 G A 12: 24,988,556 A36T probably damaging Het
Lrrtm1 G T 6: 77,244,253 R231L probably damaging Het
Micalcl A T 7: 112,412,976 S678C probably damaging Het
Mme T G 3: 63,364,867 F629C probably damaging Het
Muc5b T A 7: 141,857,341 H1341Q unknown Het
Olfr1339 T A 4: 118,734,902 D124E probably damaging Het
Olfr1391 A G 11: 49,328,202 S264G probably benign Het
Olfr495 A G 7: 108,396,089 H323R probably benign Het
Olfr513 A T 7: 108,755,569 T238S probably damaging Het
Olfr61 A G 7: 140,637,724 T8A possibly damaging Het
Parm1 A T 5: 91,593,865 M31L probably benign Het
Pcdhb18 G A 18: 37,489,821 C68Y probably benign Het
Pkn3 A T 2: 30,079,622 E35V probably damaging Het
Pla2g4a A T 1: 149,872,744 Y238N probably damaging Het
Pld6 T C 11: 59,787,271 D122G probably damaging Het
Prag1 G T 8: 36,103,255 A331S possibly damaging Het
Rbm44 A G 1: 91,168,829 D970G probably benign Het
Rps6kc1 A G 1: 190,773,654 V1037A probably benign Het
Slc12a7 T C 13: 73,805,469 V766A probably benign Het
Spata18 A G 5: 73,668,610 T87A Het
St3gal3 T C 4: 117,940,123 M308V probably benign Het
Stx19 T C 16: 62,822,286 L155S probably benign Het
Tespa1 A T 10: 130,356,883 T145S probably damaging Het
Timm21 A C 18: 84,947,721 F221V possibly damaging Het
Tlr1 A T 5: 64,924,921 F771Y probably damaging Het
Tmem150a C A 6: 72,358,623 L125I unknown Het
Try4 T C 6: 41,302,295 L4P possibly damaging Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Txndc16 A T 14: 45,144,960 N609K probably benign Het
Upf1 T C 8: 70,352,858 T46A probably benign Het
Zfp266 T C 9: 20,500,330 N184D probably benign Het
Zfp407 A G 18: 84,209,922 V1854A possibly damaging Het
Zfp626 T A 7: 27,818,370 C259S possibly damaging Het
Other mutations in Ankrd28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Ankrd28 APN 14 31743365 missense possibly damaging 0.94
IGL01335:Ankrd28 APN 14 31702024 missense probably damaging 0.99
IGL01564:Ankrd28 APN 14 31755767 missense probably damaging 1.00
IGL01624:Ankrd28 APN 14 31710857 missense probably benign 0.00
IGL01987:Ankrd28 APN 14 31778974 missense probably damaging 1.00
IGL02100:Ankrd28 APN 14 31727625 unclassified probably benign
IGL02307:Ankrd28 APN 14 31733708 missense probably damaging 1.00
IGL02656:Ankrd28 APN 14 31702240 missense possibly damaging 0.94
IGL03069:Ankrd28 APN 14 31755786 nonsense probably null
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0124:Ankrd28 UTSW 14 31727741 missense probably damaging 1.00
R0347:Ankrd28 UTSW 14 31702022 makesense probably null
R0452:Ankrd28 UTSW 14 31748738 missense probably damaging 1.00
R0685:Ankrd28 UTSW 14 31743450 unclassified probably benign
R0751:Ankrd28 UTSW 14 31764268 missense probably damaging 1.00
R1349:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1372:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1695:Ankrd28 UTSW 14 31707244 missense probably damaging 1.00
R1888:Ankrd28 UTSW 14 31732025 splice site probably benign
R1938:Ankrd28 UTSW 14 31705276 missense possibly damaging 0.74
R2001:Ankrd28 UTSW 14 31745336 missense possibly damaging 0.94
R2162:Ankrd28 UTSW 14 31708762 missense probably damaging 1.00
R2352:Ankrd28 UTSW 14 31710947 missense probably benign 0.05
R2357:Ankrd28 UTSW 14 31764294 nonsense probably null
R3545:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3548:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3710:Ankrd28 UTSW 14 31748851 splice site probably benign
R4282:Ankrd28 UTSW 14 31745225 missense possibly damaging 0.74
R4501:Ankrd28 UTSW 14 31706796 missense probably damaging 0.97
R4513:Ankrd28 UTSW 14 31743285 missense probably damaging 1.00
R4658:Ankrd28 UTSW 14 31710868 missense probably damaging 1.00
R4731:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4732:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4733:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4776:Ankrd28 UTSW 14 31732054 missense probably damaging 1.00
R4801:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R4802:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R5279:Ankrd28 UTSW 14 31735006 missense probably damaging 0.99
R5633:Ankrd28 UTSW 14 31735065 missense probably damaging 1.00
R5809:Ankrd28 UTSW 14 31743354 missense probably benign 0.19
R5959:Ankrd28 UTSW 14 31729922 missense probably benign 0.16
R6228:Ankrd28 UTSW 14 31707220 missense probably damaging 1.00
R6358:Ankrd28 UTSW 14 31710864 missense probably damaging 1.00
R6533:Ankrd28 UTSW 14 31732084 missense possibly damaging 0.49
R6598:Ankrd28 UTSW 14 31708939 missense probably damaging 1.00
R6822:Ankrd28 UTSW 14 31736840 critical splice acceptor site probably null
R7352:Ankrd28 UTSW 14 31708041 missense probably damaging 1.00
R7396:Ankrd28 UTSW 14 31702202 missense probably benign 0.00
R7462:Ankrd28 UTSW 14 31778929 missense probably benign 0.40
R7517:Ankrd28 UTSW 14 31715374 missense possibly damaging 0.65
R7629:Ankrd28 UTSW 14 31715264 missense probably benign 0.00
RF010:Ankrd28 UTSW 14 31778986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTTTCAGAACAGCATTACC -3'
(R):5'- CTGTGGGTAGATACTTAGGACATTACC -3'

Sequencing Primer
(F):5'- CAGAACAGCATTACCTTCCTTTAG -3'
(R):5'- CCTTAGGAAAATTGTATCTGTGCG -3'
Posted On2019-11-26