Incidental Mutation 'R7783:Arvcf'
ID599405
Institutional Source Beutler Lab
Gene Symbol Arvcf
Ensembl Gene ENSMUSG00000000325
Gene Namearmadillo repeat gene deleted in velocardiofacial syndrome
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7783 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location18348182-18407076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18389198 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 7 (H7Q)
Ref Sequence ENSEMBL: ENSMUSP00000087562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090103] [ENSMUST00000115610] [ENSMUST00000115612] [ENSMUST00000115613] [ENSMUST00000115614] [ENSMUST00000150253] [ENSMUST00000232025]
Predicted Effect probably benign
Transcript: ENSMUST00000090103
AA Change: H7Q

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087562
Gene: ENSMUSG00000000325
AA Change: H7Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115610
SMART Domains Protein: ENSMUSP00000111273
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
ARM 327 367 4.48e-7 SMART
ARM 370 411 3.31e-10 SMART
Blast:ARM 412 469 1e-20 BLAST
ARM 472 518 2.1e1 SMART
low complexity region 555 563 N/A INTRINSIC
ARM 582 623 9.55e1 SMART
ARM 629 669 4.05e-5 SMART
ARM 720 762 3.03e0 SMART
low complexity region 857 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115612
AA Change: H7Q

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111275
Gene: ENSMUSG00000000325
AA Change: H7Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115613
AA Change: H7Q

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111276
Gene: ENSMUSG00000000325
AA Change: H7Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115614
AA Change: H7Q

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111278
Gene: ENSMUSG00000000325
AA Change: H7Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150253
Predicted Effect probably benign
Transcript: ENSMUST00000232025
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo Repeat gene deleted in Velo-Cardio-Facial syndrome (ARVCF) is a member of the catenin family. This family plays an important role in the formation of adherens junction complexes, which are thought to facilitate communication between the inside and outside environments of a cell. The ARVCF gene was isolated in the search for the genetic defect responsible for the autosomal dominant Velo-Cardio-Facial syndrome (VCFS), a relatively common human disorder with phenotypic features including cleft palate, conotruncal heart defects and facial dysmorphology. The ARVCF gene encodes a protein containing two motifs, a coiled coil domain in the N-terminus and a 10 armadillo repeat sequence in the midregion. Since these sequences can facilitate protein-protein interactions ARVCF is thought to function in a protein complex. In addition, ARVCF contains a predicted nuclear-targeting sequence suggesting that it may have a function as a nuclear protein. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele display abnormal gait and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,812 Y447* probably null Het
Abl2 T C 1: 156,559,071 V8A probably benign Het
Adam33 C T 2: 131,058,337 R103K unknown Het
Adamts13 G T 2: 26,990,585 A727S not run Het
Alpk2 A T 18: 65,306,254 C689* probably null Het
Amt C T 9: 108,297,215 Q60* probably null Het
Ankrd12 A G 17: 66,027,250 probably null Het
Ankrd28 A T 14: 31,706,813 N920K probably damaging Het
Ankrd36 T C 11: 5,635,359 L390P probably damaging Het
Asns A G 6: 7,677,978 S367P probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
C7 T A 15: 5,007,710 H562L probably benign Het
Ccdc77 T C 6: 120,350,373 D37G probably damaging Het
Cdc14a C T 3: 116,404,587 A58T probably damaging Het
Cdc42bpb C T 12: 111,336,025 probably null Het
Corin A T 5: 72,301,624 F1068L probably benign Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Ercc3 T A 18: 32,248,243 S371T probably damaging Het
Fam193a A C 5: 34,431,180 K358Q probably damaging Het
Fem1a G A 17: 56,257,522 C205Y probably benign Het
Fh1 G A 1: 175,612,178 T233M probably damaging Het
Ftsj3 CCTTCTTCTTCTTCTTCT CCTTCTTCTTCTTCT 11: 106,252,551 probably benign Het
Gabra6 T C 11: 42,316,462 N265S probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm996 A T 2: 25,577,808 L697Q probably damaging Het
Grm6 T A 11: 50,863,082 C738S probably damaging Het
Gtsf1 C T 15: 103,428,569 probably benign Het
Hcrtr2 T A 9: 76,232,914 Y364F probably damaging Het
Ick G T 9: 78,135,645 V51F probably damaging Het
Ifit1bl1 T C 19: 34,593,936 I374V probably benign Het
Il31ra A T 13: 112,541,251 F250L probably benign Het
Iqgap1 A G 7: 80,809,059 V37A probably benign Het
Izumo3 A T 4: 92,145,023 I182K probably damaging Het
Kidins220 G A 12: 24,988,556 A36T probably damaging Het
Lrrtm1 G T 6: 77,244,253 R231L probably damaging Het
Micalcl A T 7: 112,412,976 S678C probably damaging Het
Mme T G 3: 63,364,867 F629C probably damaging Het
Muc5b T A 7: 141,857,341 H1341Q unknown Het
Olfr1339 T A 4: 118,734,902 D124E probably damaging Het
Olfr1391 A G 11: 49,328,202 S264G probably benign Het
Olfr495 A G 7: 108,396,089 H323R probably benign Het
Olfr513 A T 7: 108,755,569 T238S probably damaging Het
Olfr61 A G 7: 140,637,724 T8A possibly damaging Het
Parm1 A T 5: 91,593,865 M31L probably benign Het
Pcdhb18 G A 18: 37,489,821 C68Y probably benign Het
Pkn3 A T 2: 30,079,622 E35V probably damaging Het
Pla2g4a A T 1: 149,872,744 Y238N probably damaging Het
Pld6 T C 11: 59,787,271 D122G probably damaging Het
Prag1 G T 8: 36,103,255 A331S possibly damaging Het
Rbm44 A G 1: 91,168,829 D970G probably benign Het
Rps6kc1 A G 1: 190,773,654 V1037A probably benign Het
Slc12a7 T C 13: 73,805,469 V766A probably benign Het
Spata18 A G 5: 73,668,610 T87A Het
St3gal3 T C 4: 117,940,123 M308V probably benign Het
Stx19 T C 16: 62,822,286 L155S probably benign Het
Tespa1 A T 10: 130,356,883 T145S probably damaging Het
Timm21 A C 18: 84,947,721 F221V possibly damaging Het
Tlr1 A T 5: 64,924,921 F771Y probably damaging Het
Tmem150a C A 6: 72,358,623 L125I unknown Het
Try4 T C 6: 41,302,295 L4P possibly damaging Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Txndc16 A T 14: 45,144,960 N609K probably benign Het
Upf1 T C 8: 70,352,858 T46A probably benign Het
Zfp266 T C 9: 20,500,330 N184D probably benign Het
Zfp407 A G 18: 84,209,922 V1854A possibly damaging Het
Zfp626 T A 7: 27,818,370 C259S possibly damaging Het
Other mutations in Arvcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Arvcf APN 16 18403900 missense probably damaging 1.00
IGL02901:Arvcf APN 16 18398242 missense probably damaging 0.99
IGL03218:Arvcf APN 16 18404125 splice site probably benign
IGL03239:Arvcf APN 16 18397067 missense probably damaging 1.00
PIT4466001:Arvcf UTSW 16 18402949 missense possibly damaging 0.91
PIT4472001:Arvcf UTSW 16 18402949 missense possibly damaging 0.91
R0045:Arvcf UTSW 16 18403458 missense probably benign 0.40
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0873:Arvcf UTSW 16 18400205 nonsense probably null
R1227:Arvcf UTSW 16 18389304 missense probably benign 0.00
R1495:Arvcf UTSW 16 18389386 missense probably damaging 0.96
R1717:Arvcf UTSW 16 18401569 missense possibly damaging 0.52
R2021:Arvcf UTSW 16 18399732 missense probably damaging 1.00
R3873:Arvcf UTSW 16 18403033 missense probably damaging 1.00
R4095:Arvcf UTSW 16 18401577 missense probably damaging 1.00
R4280:Arvcf UTSW 16 18397991 missense probably damaging 1.00
R4496:Arvcf UTSW 16 18405182 missense probably damaging 0.96
R4887:Arvcf UTSW 16 18398113 nonsense probably null
R5068:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5069:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5070:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5322:Arvcf UTSW 16 18397643 missense probably benign 0.00
R5400:Arvcf UTSW 16 18399070 missense probably benign 0.17
R6376:Arvcf UTSW 16 18405132 missense probably damaging 0.98
R6771:Arvcf UTSW 16 18403864 missense probably benign
R7106:Arvcf UTSW 16 18399049 missense probably damaging 0.99
R7176:Arvcf UTSW 16 18399727 missense probably damaging 1.00
R7202:Arvcf UTSW 16 18405198 missense probably damaging 1.00
R7412:Arvcf UTSW 16 18401600 missense probably benign 0.03
R7737:Arvcf UTSW 16 18397101 missense probably damaging 1.00
Z1088:Arvcf UTSW 16 18402641 missense probably damaging 1.00
Z1177:Arvcf UTSW 16 18389299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCAATGCAGCTTCCCTCC -3'
(R):5'- GGCTGTCTTTACCATGTCCCAG -3'

Sequencing Primer
(F):5'- ATGCAGCTTCCCTCCAGAGAG -3'
(R):5'- ATGTCCCAGACTATTACCTGCAG -3'
Posted On2019-11-26