Incidental Mutation 'R7784:Slc9a4'
ID 599416
Institutional Source Beutler Lab
Gene Symbol Slc9a4
Ensembl Gene ENSMUSG00000026065
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms D730009J23Rik, NHE4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 40580081-40630725 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40600776 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 243 (Y243H)
Ref Sequence ENSEMBL: ENSMUSP00000027233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027233]
AlphaFold Q8BUE1
Predicted Effect probably damaging
Transcript: ENSMUST00000027233
AA Change: Y243H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027233
Gene: ENSMUSG00000026065
AA Change: Y243H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_H_Exchanger 73 477 1.6e-90 PFAM
PDB:2E30|B 481 516 9e-8 PDB
Pfam:NEXCaM_BD 566 675 8.1e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous null mice display normal growth and survival but have gastric secretions with reduced acidity, mild gastric necrosis and apoptosis, and abnormal gastric mucosa with reduced numbers of parietal and chief cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Slc9a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc9a4 APN 1 40629405 missense probably benign 0.01
IGL01802:Slc9a4 APN 1 40607798 missense probably damaging 1.00
IGL01909:Slc9a4 APN 1 40612291 splice site probably benign
IGL02137:Slc9a4 APN 1 40600899 missense possibly damaging 0.79
IGL02399:Slc9a4 APN 1 40600782 missense probably benign 0.00
IGL02685:Slc9a4 APN 1 40629582 missense probably benign
IGL02874:Slc9a4 APN 1 40584038 missense probably benign 0.02
IGL02892:Slc9a4 APN 1 40584044 missense possibly damaging 0.64
IGL03028:Slc9a4 APN 1 40610377 missense probably benign 0.06
IGL03083:Slc9a4 APN 1 40629402 missense probably benign 0.00
IGL03124:Slc9a4 APN 1 40580735 missense probably damaging 0.99
IGL03144:Slc9a4 APN 1 40612202 missense probably damaging 1.00
IGL03286:Slc9a4 APN 1 40580768 missense probably null 0.99
R0601:Slc9a4 UTSW 1 40603070 missense probably damaging 1.00
R1118:Slc9a4 UTSW 1 40584330 splice site probably benign
R1583:Slc9a4 UTSW 1 40600962 missense probably benign 0.01
R1752:Slc9a4 UTSW 1 40629261 missense probably benign 0.00
R1776:Slc9a4 UTSW 1 40629287 missense probably benign 0.00
R1785:Slc9a4 UTSW 1 40607741 splice site probably null
R1786:Slc9a4 UTSW 1 40607741 splice site probably null
R2131:Slc9a4 UTSW 1 40607741 splice site probably null
R2132:Slc9a4 UTSW 1 40607741 splice site probably null
R2133:Slc9a4 UTSW 1 40607741 splice site probably null
R3785:Slc9a4 UTSW 1 40583970 missense probably damaging 1.00
R4223:Slc9a4 UTSW 1 40619126 missense probably damaging 0.98
R4567:Slc9a4 UTSW 1 40580577 missense probably damaging 0.99
R4605:Slc9a4 UTSW 1 40601035 splice site probably null
R4641:Slc9a4 UTSW 1 40607125 missense probably damaging 1.00
R5407:Slc9a4 UTSW 1 40607794 missense probably benign 0.41
R5823:Slc9a4 UTSW 1 40619117 missense probably damaging 0.97
R5877:Slc9a4 UTSW 1 40612263 missense probably benign
R6389:Slc9a4 UTSW 1 40580684 missense probably benign 0.00
R6430:Slc9a4 UTSW 1 40600854 nonsense probably null
R6603:Slc9a4 UTSW 1 40623504 missense probably benign 0.43
R6950:Slc9a4 UTSW 1 40602885 missense probably damaging 1.00
R7102:Slc9a4 UTSW 1 40580639 missense probably benign 0.00
R7102:Slc9a4 UTSW 1 40623399 missense probably damaging 1.00
R7230:Slc9a4 UTSW 1 40600771 missense probably damaging 1.00
R7313:Slc9a4 UTSW 1 40629503 missense probably benign 0.28
R7384:Slc9a4 UTSW 1 40612251 missense probably benign 0.10
R7405:Slc9a4 UTSW 1 40600926 missense probably damaging 1.00
R7770:Slc9a4 UTSW 1 40600963 missense probably damaging 0.98
R8313:Slc9a4 UTSW 1 40580360 start gained probably benign
R8724:Slc9a4 UTSW 1 40584141 missense probably damaging 0.98
R8871:Slc9a4 UTSW 1 40602855 missense probably damaging 1.00
R8926:Slc9a4 UTSW 1 40580768 missense possibly damaging 0.71
R9244:Slc9a4 UTSW 1 40619089 missense probably damaging 0.99
X0060:Slc9a4 UTSW 1 40619031 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAGGTAATTCACATCCCCACC -3'
(R):5'- AGACGATGAGGGGCTCAATC -3'

Sequencing Primer
(F):5'- TGTCATGCGCTCAATTATGAAACCC -3'
(R):5'- GGCTCAATCGCAGAGATGTTC -3'
Posted On 2019-11-26