Incidental Mutation 'R7784:Sept2'
ID 599419
Institutional Source Beutler Lab
Gene Symbol Sept2
Ensembl Gene ENSMUSG00000026276
Gene Name septin 2
Synonyms Nedd5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 93478964-93510260 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93497444 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 107 (D107E)
Ref Sequence ENSEMBL: ENSMUSP00000027495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027495] [ENSMUST00000112912] [ENSMUST00000129211] [ENSMUST00000131175] [ENSMUST00000136182] [ENSMUST00000142401] [ENSMUST00000149532] [ENSMUST00000150931] [ENSMUST00000153826] [ENSMUST00000168776] [ENSMUST00000172165] [ENSMUST00000179353]
AlphaFold P42208
PDB Structure Crystal structure of Septin 2 in complex with GppNHp and Mg2+ [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027495
AA Change: D107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027495
Gene: ENSMUSG00000026276
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112912
AA Change: D107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108534
Gene: ENSMUSG00000026276
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129211
AA Change: D107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120511
Gene: ENSMUSG00000026276
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Septin 34 213 4.9e-85 PFAM
Pfam:AIG1 38 131 9.9e-7 PFAM
Pfam:MMR_HSR1 39 211 1.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131175
AA Change: D107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120694
Gene: ENSMUSG00000026276
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Septin 34 212 6.5e-85 PFAM
Pfam:AIG1 38 131 9.8e-7 PFAM
Pfam:MMR_HSR1 39 211 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136182
AA Change: D67E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118621
Gene: ENSMUSG00000026276
AA Change: D67E

DomainStartEndE-ValueType
Pfam:AIG1 1 96 1.4e-6 PFAM
Pfam:MMR_HSR1 1 103 1.3e-8 PFAM
Pfam:Septin 1 107 6.4e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142401
AA Change: D137E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121974
Gene: ENSMUSG00000026276
AA Change: D137E

DomainStartEndE-ValueType
Pfam:Septin 64 177 4.9e-49 PFAM
Pfam:AIG1 68 159 2.3e-7 PFAM
Pfam:MMR_HSR1 69 172 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149532
AA Change: D107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115536
Gene: ENSMUSG00000026276
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Septin 34 120 7e-35 PFAM
Pfam:GTP_EFTU 37 110 9.5e-6 PFAM
Pfam:AIG1 38 120 3.4e-7 PFAM
Pfam:Ras 39 115 1.2e-5 PFAM
Pfam:MMR_HSR1 39 118 2.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150931
AA Change: D107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117517
Gene: ENSMUSG00000026276
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153826
SMART Domains Protein: ENSMUSP00000114614
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 77 4.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168776
AA Change: D107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132850
Gene: ENSMUSG00000116048
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.4e-129 PFAM
Pfam:MMR_HSR1 39 240 1.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172165
AA Change: D67E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127276
Gene: ENSMUSG00000116048
AA Change: D67E

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 203 5.8e-8 PFAM
Pfam:Septin 1 273 1.5e-125 PFAM
coiled coil region 277 308 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179353
AA Change: D107E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136366
Gene: ENSMUSG00000116048
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Sept2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Sept2 APN 1 93499142 missense probably damaging 1.00
IGL01909:Sept2 APN 1 93499101 missense probably damaging 1.00
IGL02504:Sept2 APN 1 93500481 missense probably benign 0.06
R0136:Sept2 UTSW 1 93507050 missense possibly damaging 0.57
R0140:Sept2 UTSW 1 93501639 missense probably damaging 1.00
R0335:Sept2 UTSW 1 93495599 missense probably damaging 1.00
R0538:Sept2 UTSW 1 93501623 missense probably damaging 1.00
R1370:Sept2 UTSW 1 93499106 missense probably damaging 1.00
R1463:Sept2 UTSW 1 93499315 missense possibly damaging 0.79
R4832:Sept2 UTSW 1 93499127 missense probably damaging 0.98
R5443:Sept2 UTSW 1 93497452 missense possibly damaging 0.95
R5845:Sept2 UTSW 1 93499035 splice site probably null
R5898:Sept2 UTSW 1 93479301 missense probably benign
R6122:Sept2 UTSW 1 93497376 missense probably damaging 1.00
R6542:Sept2 UTSW 1 93497466 critical splice donor site probably null
R8074:Sept2 UTSW 1 93505561 missense probably benign
R8266:Sept2 UTSW 1 93501526 missense possibly damaging 0.91
R8277:Sept2 UTSW 1 93499308 missense probably benign 0.20
R9154:Sept2 UTSW 1 93501588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATATCTCTCCTTCTAGCATGC -3'
(R):5'- GCTGCAGTCTGTATTACAGTGC -3'

Sequencing Primer
(F):5'- GCATGCTGCCTTGATTTTTAAGTAC -3'
(R):5'- ATTCTGAGTTCAAGGCCAGC -3'
Posted On 2019-11-26