Incidental Mutation 'R7784:Spta1'
ID 599421
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Name spectrin alpha, erythrocytic 1
Synonyms erythroid, Spna-1, ihj, Spna1
MMRRC Submission 045840-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.866) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 174172776-174248450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 174202451 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 928 (D928N)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
AlphaFold P08032
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: D928N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: D928N

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
bounced UTSW 1 174224457 missense probably damaging 1.00
Capillus UTSW 1 174217688 critical splice donor site probably null
Deflection UTSW 1 174241087 missense probably damaging 1.00
Goldfoil UTSW 1 174218512 missense probably damaging 1.00
hanging UTSW 1 174178749 missense probably damaging 0.99
Klimt UTSW 1 174202386 missense probably damaging 1.00
Rutherford UTSW 1 174207110 missense probably null 1.00
Thread UTSW 1 174197635 nonsense probably null
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 splice site probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 splice site probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
R7193:Spta1 UTSW 1 174184612 missense probably damaging 1.00
R7199:Spta1 UTSW 1 174223271 missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174222637 missense probably damaging 0.96
R7343:Spta1 UTSW 1 174223349 missense probably damaging 0.99
R7372:Spta1 UTSW 1 174197635 nonsense probably null
R7472:Spta1 UTSW 1 174246499 missense probably damaging 1.00
R7516:Spta1 UTSW 1 174197783 missense probably damaging 1.00
R7627:Spta1 UTSW 1 174205378 missense probably damaging 1.00
R7770:Spta1 UTSW 1 174195981 nonsense probably null
R7804:Spta1 UTSW 1 174195905 missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174218830 critical splice donor site probably null
R7862:Spta1 UTSW 1 174197785 critical splice donor site probably null
R7958:Spta1 UTSW 1 174174390 missense probably benign 0.03
R8015:Spta1 UTSW 1 174240171 missense probably damaging 1.00
R8059:Spta1 UTSW 1 174218370 intron probably benign
R8076:Spta1 UTSW 1 174187231 missense probably benign 0.00
R8152:Spta1 UTSW 1 174217944 missense probably benign 0.03
R8235:Spta1 UTSW 1 174202386 missense probably damaging 1.00
R8284:Spta1 UTSW 1 174179821 missense probably benign 0.00
R8298:Spta1 UTSW 1 174247387 missense probably damaging 1.00
R8312:Spta1 UTSW 1 174240211 missense probably damaging 1.00
R8495:Spta1 UTSW 1 174215485 missense probably benign 0.00
R8550:Spta1 UTSW 1 174187208 missense probably damaging 1.00
R8675:Spta1 UTSW 1 174230683 missense probably benign 0.01
R8757:Spta1 UTSW 1 174213374 missense probably damaging 1.00
R8759:Spta1 UTSW 1 174213374 missense probably damaging 1.00
R8848:Spta1 UTSW 1 174197744 missense probably benign 0.05
R8883:Spta1 UTSW 1 174193579 missense possibly damaging 0.82
R8884:Spta1 UTSW 1 174217688 critical splice donor site probably null
R8896:Spta1 UTSW 1 174217982 missense probably damaging 1.00
R8953:Spta1 UTSW 1 174230675 missense probably benign 0.10
R9006:Spta1 UTSW 1 174219971 missense probably damaging 1.00
R9013:Spta1 UTSW 1 174222608 missense probably damaging 1.00
R9077:Spta1 UTSW 1 174217604 missense probably damaging 1.00
R9129:Spta1 UTSW 1 174231345 missense possibly damaging 0.77
R9207:Spta1 UTSW 1 174211573 missense probably benign 0.01
R9229:Spta1 UTSW 1 174240184 missense probably damaging 1.00
R9281:Spta1 UTSW 1 174219878 missense probably damaging 1.00
R9290:Spta1 UTSW 1 174217638 missense possibly damaging 0.94
R9307:Spta1 UTSW 1 174208412 missense probably damaging 1.00
R9489:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R9605:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R9685:Spta1 UTSW 1 174205359 missense probably damaging 1.00
RF002:Spta1 UTSW 1 174231360 missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174209319 missense probably damaging 1.00
RF020:Spta1 UTSW 1 174213444 missense probably benign 0.42
RF020:Spta1 UTSW 1 174217903 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174191051 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174240367 missense probably damaging 0.99
Z1177:Spta1 UTSW 1 174190162 missense probably benign 0.09
Z1177:Spta1 UTSW 1 174245689 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATAGCATCTAGGGTTGAAAGCTTG -3'
(R):5'- TCACAGACTTTGGAATTTGGTTCTC -3'

Sequencing Primer
(F):5'- GCTTGAACAAAAATATGGAGTCTCTC -3'
(R):5'- CTCTGCTAACATTGAGGCT -3'
Posted On 2019-11-26