Mutagenetix > Incidental Mutation

Incidental Mutation 'R7784:Spta1'

599421

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

045840-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R7784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

174000342-174076016 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 174030017 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 928 (D928N)

Ref Sequence

ENSEMBL: ENSMUSP00000027817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817]

AlphaFold

P08032

Predicted Effect

probably damaging
Transcript: ENSMUST00000027817
AA Change: D928N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: D928N

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	A	T	5: 146,119,638 (GRCm39)		probably null	Het
3425401B19Rik	A	T	14: 32,381,797 (GRCm39)	S1389R	probably benign	Het
Abca9	A	T	11: 110,045,243 (GRCm39)	C363*	probably null	Het
Actbl2	T	A	13: 111,391,945 (GRCm39)	N93K	probably damaging	Het
Adamtsl3	T	C	7: 82,223,197 (GRCm39)	Y993H	probably damaging	Het
Adgrg1	G	A	8: 95,739,510 (GRCm39)	W653*	probably null	Het
Akap13	T	A	7: 75,260,076 (GRCm39)	V97D	probably benign	Het
Cacna1d	T	A	14: 29,845,396 (GRCm39)	D613V	probably damaging	Het
Col10a1	C	A	10: 34,270,214 (GRCm39)	P62H	unknown	Het
Cpb2	A	T	14: 75,512,480 (GRCm39)	N298Y	probably damaging	Het
Ddc	A	G	11: 11,789,396 (GRCm39)		probably null	Het
Ddx6	T	C	9: 44,541,439 (GRCm39)		probably null	Het
Epb42	T	G	2: 120,864,916 (GRCm39)	K58N	probably benign	Het
Eps8	T	A	6: 137,476,585 (GRCm39)	I605L	probably benign	Het
Eps8l1	T	C	7: 4,475,121 (GRCm39)	L304P	probably damaging	Het
Erbb4	T	A	1: 68,114,658 (GRCm39)	I929F	probably damaging	Het
Erc2	A	T	14: 27,620,551 (GRCm39)	N393I	probably damaging	Het
Fbxw25	C	T	9: 109,479,187 (GRCm39)	D355N		Het
Ffar2	T	C	7: 30,518,683 (GRCm39)	K286E	probably benign	Het
Gabrd	A	G	4: 155,473,389 (GRCm39)		probably null	Het
Ganc	G	A	2: 120,267,149 (GRCm39)	W488*	probably null	Het
Ifi207	T	A	1: 173,557,698 (GRCm39)	M347L	unknown	Het
Kat6b	A	T	14: 21,710,909 (GRCm39)	I619F	probably damaging	Het
Kif26a	A	G	12: 112,144,581 (GRCm39)	R1612G	possibly damaging	Het
Kifc3	A	G	8: 95,837,320 (GRCm39)		probably null	Het
Krt39	A	T	11: 99,411,857 (GRCm39)	C76*	probably null	Het
Lcmt1	G	T	7: 123,000,718 (GRCm39)	R84L	probably benign	Het
Lrit1	A	G	14: 36,783,737 (GRCm39)	Y355C	probably benign	Het
Mad2l1	C	A	6: 66,512,397 (GRCm39)		probably null	Het
Med23	C	T	10: 24,778,346 (GRCm39)	T870M	probably damaging	Het
Mrpl2	A	G	17: 46,959,517 (GRCm39)		probably null	Het
Mtmr6	A	G	14: 60,537,894 (GRCm39)	D593G	probably benign	Het
Myo15b	G	A	11: 115,752,166 (GRCm39)	V683M		Het
Neb	T	A	2: 52,125,500 (GRCm39)	M506L		Het
Or12d13	T	C	17: 37,647,469 (GRCm39)	Y218C	probably benign	Het
Or12d13	A	G	17: 37,647,946 (GRCm39)	F59S	probably damaging	Het
Or2a20	T	A	6: 43,194,322 (GRCm39)	H158Q	possibly damaging	Het
Or9m1	G	A	2: 87,733,537 (GRCm39)	T161I	probably benign	Het
Pdzd8	A	G	19: 59,316,295 (GRCm39)	F294L	probably damaging	Het
Rabgap1	G	A	2: 37,377,544 (GRCm39)	S347N	possibly damaging	Het
Rasgrf2	T	C	13: 92,044,201 (GRCm39)	T350A		Het
Rbp3	A	T	14: 33,676,115 (GRCm39)	H21L	probably benign	Het
Rp1	C	A	1: 4,212,881 (GRCm39)	V1069F	unknown	Het
Rtn4	T	A	11: 29,691,048 (GRCm39)	L1113*	probably null	Het
Ryr3	A	G	2: 112,606,040 (GRCm39)	F2407L	probably damaging	Het
Septin2	T	A	1: 93,425,166 (GRCm39)	D107E	probably damaging	Het
Septin4	A	G	11: 87,469,834 (GRCm39)	T7A	probably benign	Het
Slc34a3	T	A	2: 25,122,237 (GRCm39)	I123F	probably damaging	Het
Slc9a4	T	C	1: 40,639,936 (GRCm39)	Y243H	probably damaging	Het
Slco1a1	T	A	6: 141,889,114 (GRCm39)	E66V	probably damaging	Het
Slco1a7	C	T	6: 141,658,919 (GRCm39)		probably null	Het
Sp140l2	T	A	1: 85,190,195 (GRCm39)		probably null	Het
Spata33	A	G	8: 123,939,991 (GRCm39)	R68G	unknown	Het
St8sia5	A	G	18: 77,342,246 (GRCm39)	S319G	probably benign	Het
Tmem208	A	G	8: 106,055,465 (GRCm39)	D149G	possibly damaging	Het
Trank1	A	T	9: 111,193,171 (GRCm39)	I583F	probably damaging	Het
Trio	C	T	15: 27,764,080 (GRCm39)	V2015M	probably damaging	Het
Tsc22d1	C	T	14: 76,654,141 (GRCm39)	Q207*	probably null	Het
Tshr	A	G	12: 91,472,079 (GRCm39)	D143G	probably benign	Het
Txlna	C	T	4: 129,525,950 (GRCm39)	R299H	probably damaging	Het
Ush2a	A	T	1: 188,176,789 (GRCm39)	T1318S	possibly damaging	Het
Utp14b	A	G	1: 78,642,660 (GRCm39)	K186R	probably damaging	Het
Vars2	C	T	17: 35,969,050 (GRCm39)	A884T	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,706,067 (GRCm39)		probably benign	Het
Zfp775	A	G	6: 48,596,183 (GRCm39)	Q19R	possibly damaging	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174,035,956 (GRCm39)	nonsense	probably null
IGL01095:Spta1	APN	1	174,041,051 (GRCm39)	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174,014,829 (GRCm39)	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174,030,877 (GRCm39)	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174,044,725 (GRCm39)	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174,035,960 (GRCm39)	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174,071,746 (GRCm39)	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174,001,938 (GRCm39)	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174,041,428 (GRCm39)	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174,030,860 (GRCm39)	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174,017,797 (GRCm39)	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174,045,255 (GRCm39)	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174,002,029 (GRCm39)	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174,046,380 (GRCm39)	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174,071,676 (GRCm39)	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174,039,164 (GRCm39)	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174,014,854 (GRCm39)	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174,008,624 (GRCm39)	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174,046,309 (GRCm39)	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174,041,484 (GRCm39)	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174,041,710 (GRCm39)	missense	probably benign	0.08
bounced	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
Capillus	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
Deflection	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
Goldfoil	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
hanging	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
Klimt	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
Rutherford	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
Thread	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
H8786:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174,034,598 (GRCm39)	splice site	probably benign
R0172:Spta1	UTSW	1	174,058,352 (GRCm39)	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174,045,460 (GRCm39)	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174,070,745 (GRCm39)	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174,046,017 (GRCm39)	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174,041,508 (GRCm39)	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174,008,670 (GRCm39)	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174,001,992 (GRCm39)	missense	possibly damaging	0.85
R0941:Spta1	UTSW	1	174,072,771 (GRCm39)	unclassified	probably benign
R1131:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174,039,180 (GRCm39)	nonsense	probably null
R1184:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174,050,250 (GRCm39)	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174,058,891 (GRCm39)	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174,074,919 (GRCm39)	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174,067,732 (GRCm39)	missense	possibly damaging	0.94
R1555:Spta1	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
R1566:Spta1	UTSW	1	174,012,272 (GRCm39)	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174,041,061 (GRCm39)	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174,068,608 (GRCm39)	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174,073,296 (GRCm39)	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174,074,115 (GRCm39)	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174,023,513 (GRCm39)	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174,047,405 (GRCm39)	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174,039,213 (GRCm39)	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174,071,764 (GRCm39)	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174,035,910 (GRCm39)	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174,040,180 (GRCm39)	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174,056,824 (GRCm39)	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174,020,532 (GRCm39)	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174,071,680 (GRCm39)	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174,001,907 (GRCm39)	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174,006,222 (GRCm39)	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174,068,703 (GRCm39)	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4082:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174,002,122 (GRCm39)	missense	probably benign	0.01
R4115:Spta1	UTSW	1	174,067,923 (GRCm39)	missense	probably damaging	1.00
R4303:Spta1	UTSW	1	174,007,418 (GRCm39)	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174,074,990 (GRCm39)	nonsense	probably null
R4525:Spta1	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
R4614:Spta1	UTSW	1	174,020,543 (GRCm39)	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174,018,628 (GRCm39)	splice site	probably null
R4782:Spta1	UTSW	1	174,058,232 (GRCm39)	missense	probably benign	0.01
R4825:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R4829:Spta1	UTSW	1	174,065,493 (GRCm39)	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174,065,400 (GRCm39)	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174,045,429 (GRCm39)	splice site	probably null
R4911:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174,018,622 (GRCm39)	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174,074,174 (GRCm39)	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174,067,789 (GRCm39)	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174,075,000 (GRCm39)	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174,023,551 (GRCm39)	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174,043,095 (GRCm39)	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174,044,759 (GRCm39)	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174,003,336 (GRCm39)	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174,047,468 (GRCm39)	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174,041,821 (GRCm39)	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174,012,363 (GRCm39)	splice site	probably null
R5845:Spta1	UTSW	1	174,068,662 (GRCm39)	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174,050,894 (GRCm39)	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174,052,086 (GRCm39)	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174,009,342 (GRCm39)	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174,041,743 (GRCm39)	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174,039,212 (GRCm39)	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174,041,734 (GRCm39)	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174,030,888 (GRCm39)	missense	probably benign
R6387:Spta1	UTSW	1	174,058,899 (GRCm39)	missense	probably benign	0.01
R6451:Spta1	UTSW	1	174,044,767 (GRCm39)	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174,014,714 (GRCm39)	splice site	probably null
R6533:Spta1	UTSW	1	174,071,713 (GRCm39)	missense	probably damaging	1.00
R6585:Spta1	UTSW	1	174,006,251 (GRCm39)	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174,036,891 (GRCm39)	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174,036,918 (GRCm39)	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174,027,050 (GRCm39)	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174,002,076 (GRCm39)	missense	probably benign
R7151:Spta1	UTSW	1	174,025,317 (GRCm39)	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174,012,178 (GRCm39)	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174,050,837 (GRCm39)	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174,050,203 (GRCm39)	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174,050,915 (GRCm39)	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
R7472:Spta1	UTSW	1	174,074,065 (GRCm39)	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174,025,349 (GRCm39)	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174,032,944 (GRCm39)	missense	probably damaging	1.00
R7770:Spta1	UTSW	1	174,023,547 (GRCm39)	nonsense	probably null
R7804:Spta1	UTSW	1	174,023,471 (GRCm39)	missense	possibly damaging	0.50
R7854:Spta1	UTSW	1	174,046,396 (GRCm39)	critical splice donor site	probably null
R7862:Spta1	UTSW	1	174,025,351 (GRCm39)	critical splice donor site	probably null
R7958:Spta1	UTSW	1	174,001,956 (GRCm39)	missense	probably benign	0.03
R8015:Spta1	UTSW	1	174,067,737 (GRCm39)	missense	probably damaging	1.00
R8059:Spta1	UTSW	1	174,045,936 (GRCm39)	intron	probably benign
R8076:Spta1	UTSW	1	174,014,797 (GRCm39)	missense	probably benign	0.00
R8152:Spta1	UTSW	1	174,045,510 (GRCm39)	missense	probably benign	0.03
R8235:Spta1	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
R8284:Spta1	UTSW	1	174,007,387 (GRCm39)	missense	probably benign	0.00
R8298:Spta1	UTSW	1	174,074,953 (GRCm39)	missense	probably damaging	1.00
R8312:Spta1	UTSW	1	174,067,777 (GRCm39)	missense	probably damaging	1.00
R8495:Spta1	UTSW	1	174,043,051 (GRCm39)	missense	probably benign	0.00
R8550:Spta1	UTSW	1	174,014,774 (GRCm39)	missense	probably damaging	1.00
R8675:Spta1	UTSW	1	174,058,249 (GRCm39)	missense	probably benign	0.01
R8757:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8759:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8848:Spta1	UTSW	1	174,025,310 (GRCm39)	missense	probably benign	0.05
R8883:Spta1	UTSW	1	174,021,145 (GRCm39)	missense	possibly damaging	0.82
R8884:Spta1	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
R8896:Spta1	UTSW	1	174,045,548 (GRCm39)	missense	probably damaging	1.00
R8953:Spta1	UTSW	1	174,058,241 (GRCm39)	missense	probably benign	0.10
R9006:Spta1	UTSW	1	174,047,537 (GRCm39)	missense	probably damaging	1.00
R9013:Spta1	UTSW	1	174,050,174 (GRCm39)	missense	probably damaging	1.00
R9077:Spta1	UTSW	1	174,045,170 (GRCm39)	missense	probably damaging	1.00
R9129:Spta1	UTSW	1	174,058,911 (GRCm39)	missense	possibly damaging	0.77
R9207:Spta1	UTSW	1	174,039,139 (GRCm39)	missense	probably benign	0.01
R9229:Spta1	UTSW	1	174,067,750 (GRCm39)	missense	probably damaging	1.00
R9281:Spta1	UTSW	1	174,047,444 (GRCm39)	missense	probably damaging	1.00
R9290:Spta1	UTSW	1	174,045,204 (GRCm39)	missense	possibly damaging	0.94
R9307:Spta1	UTSW	1	174,035,978 (GRCm39)	missense	probably damaging	1.00
R9489:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9605:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9685:Spta1	UTSW	1	174,032,925 (GRCm39)	missense	probably damaging	1.00
RF002:Spta1	UTSW	1	174,058,926 (GRCm39)	missense	possibly damaging	0.62
RF018:Spta1	UTSW	1	174,036,885 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,045,469 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,041,010 (GRCm39)	missense	probably benign	0.42
T0722:Spta1	UTSW	1	174,018,632 (GRCm39)	splice site	probably benign
X0028:Spta1	UTSW	1	174,052,016 (GRCm39)	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	probably damaging	0.99
Z1176:Spta1	UTSW	1	174,018,617 (GRCm39)	missense	probably damaging	1.00
Z1177:Spta1	UTSW	1	174,073,255 (GRCm39)	missense	probably benign	0.02
Z1177:Spta1	UTSW	1	174,017,728 (GRCm39)	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- ATAGCATCTAGGGTTGAAAGCTTG -3'
(R):5'- TCACAGACTTTGGAATTTGGTTCTC -3'

Sequencing Primer
(F):5'- GCTTGAACAAAAATATGGAGTCTCTC -3'
(R):5'- CTCTGCTAACATTGAGGCT -3'

Posted On

2019-11-26