Incidental Mutation 'R7784:Ush2a'
ID 599422
Institutional Source Beutler Lab
Gene Symbol Ush2a
Ensembl Gene ENSMUSG00000026609
Gene Name usherin
Synonyms A930011D15Rik, LOC381317, A930037M10Rik, LOC269160, Usherin, MUSH2A
MMRRC Submission 045840-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.699) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 188262023-188965041 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 188444592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1318 (T1318S)
Ref Sequence ENSEMBL: ENSMUSP00000050454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060479]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000060479
AA Change: T1318S

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050454
Gene: ENSMUSG00000026609
AA Change: T1318S

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Laminin_G_3 128 283 6.5e-16 PFAM
LamNT 310 513 6.79e-9 SMART
EGF_Lam 515 569 1.58e-3 SMART
EGF_Lam 572 635 5.69e-10 SMART
EGF_Lam 638 688 4.38e-11 SMART
EGF_Lam 691 741 3.56e-11 SMART
EGF_Lam 744 789 7.93e-9 SMART
EGF_Lam 792 841 3.37e-12 SMART
EGF_Lam 844 894 2.01e-10 SMART
EGF_Lam 897 945 5.43e-16 SMART
EGF_Lam 948 996 7.88e-4 SMART
EGF_Lam 999 1047 2.96e-8 SMART
FN3 1051 1130 1e-1 SMART
FN3 1145 1224 2.06e-3 SMART
FN3 1239 1342 8.69e-11 SMART
FN3 1356 1447 5.32e-6 SMART
FN3 1461 1570 2.63e1 SMART
LamG 1531 1672 5.39e-19 SMART
LamG 1727 1862 2.33e-23 SMART
FN3 1861 1931 9.15e1 SMART
FN3 1945 2032 2.24e-4 SMART
FN3 2047 2120 1.13e0 SMART
FN3 2134 2218 3.4e-4 SMART
FN3 2232 2306 1.59e-4 SMART
FN3 2320 2412 1.12e-4 SMART
FN3 2423 2510 8.9e-8 SMART
FN3 2524 2600 1.95e-4 SMART
FN3 2612 2701 4.67e-2 SMART
FN3 2715 2792 1.17e-7 SMART
FN3 2809 2902 1.12e-4 SMART
FN3 2913 2997 5.36e-2 SMART
FN3 3011 3089 2.46e-1 SMART
FN3 3101 3477 2.85e1 SMART
FN3 3491 3568 4e-1 SMART
FN3 3582 3659 5.87e-8 SMART
FN3 3673 3750 1.75e-6 SMART
FN3 3764 3845 9.62e-4 SMART
FN3 3859 3943 2.41e-4 SMART
FN3 3954 4044 5.11e-8 SMART
FN3 4058 4133 1.06e0 SMART
FN3 4147 4241 7.87e-9 SMART
FN3 4255 4334 1.15e-1 SMART
FN3 4348 4422 6.39e-9 SMART
FN3 4435 4510 6.91e-5 SMART
FN3 4521 4610 2.28e-5 SMART
FN3 4626 4713 1.71e0 SMART
FN3 4724 4805 1.3e0 SMART
FN3 4817 4909 3.62e-8 SMART
transmembrane domain 5032 5054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains laminin EGF motifs, a pentaxin domain, and many fibronectin type III motifs. The protein is found in the basement membrane, and may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIa and retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display progressive retinal photoreceptor degeneration along with significantly reduced a- and b-wave amplitudes, and a moderate but nonprogressive high-frequency hearing loss associated with widespread loss of outer hair cells in the basal turn of the cochlea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 (GRCm38) probably null Het
3425401B19Rik A T 14: 32,659,840 (GRCm38) S1389R probably benign Het
Abca9 A T 11: 110,154,417 (GRCm38) C363* probably null Het
Actbl2 T A 13: 111,255,411 (GRCm38) N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 (GRCm38) Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 (GRCm38) W653* probably null Het
Akap13 T A 7: 75,610,328 (GRCm38) V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 (GRCm38) probably null Het
Cacna1d T A 14: 30,123,439 (GRCm38) D613V probably damaging Het
Col10a1 C A 10: 34,394,218 (GRCm38) P62H unknown Het
Cpb2 A T 14: 75,275,040 (GRCm38) N298Y probably damaging Het
Ddc A G 11: 11,839,396 (GRCm38) probably null Het
Ddx6 T C 9: 44,630,142 (GRCm38) probably null Het
Epb42 T G 2: 121,034,435 (GRCm38) K58N probably benign Het
Eps8 T A 6: 137,499,587 (GRCm38) I605L probably benign Het
Eps8l1 T C 7: 4,472,122 (GRCm38) L304P probably damaging Het
Erbb4 T A 1: 68,075,499 (GRCm38) I929F probably damaging Het
Erc2 A T 14: 27,898,594 (GRCm38) N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 (GRCm38) D355N Het
Ffar2 T C 7: 30,819,258 (GRCm38) K286E probably benign Het
Gabrd A G 4: 155,388,932 (GRCm38) probably null Het
Ganc G A 2: 120,436,668 (GRCm38) W488* probably null Het
Gm5724 C T 6: 141,713,193 (GRCm38) probably null Het
Ifi207 T A 1: 173,730,132 (GRCm38) M347L unknown Het
Kat6b A T 14: 21,660,841 (GRCm38) I619F probably damaging Het
Kif26a A G 12: 112,178,147 (GRCm38) R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 (GRCm38) probably null Het
Krt39 A T 11: 99,521,031 (GRCm38) C76* probably null Het
Lcmt1 G T 7: 123,401,495 (GRCm38) R84L probably benign Het
Lrit1 A G 14: 37,061,780 (GRCm38) Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 (GRCm38) probably null Het
Med23 C T 10: 24,902,448 (GRCm38) T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 (GRCm38) probably null Het
Mtmr6 A G 14: 60,300,445 (GRCm38) D593G probably benign Het
Myo15b G A 11: 115,861,340 (GRCm38) V683M Het
Neb T A 2: 52,235,488 (GRCm38) M506L Het
Olfr103 T C 17: 37,336,578 (GRCm38) Y218C probably benign Het
Olfr103 A G 17: 37,337,055 (GRCm38) F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 (GRCm38) T161I probably benign Het
Olfr434 T A 6: 43,217,388 (GRCm38) H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 (GRCm38) F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 (GRCm38) S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 (GRCm38) T350A Het
Rbp3 A T 14: 33,954,158 (GRCm38) H21L probably benign Het
Rp1 C A 1: 4,142,658 (GRCm38) V1069F unknown Het
Rtn4 T A 11: 29,741,048 (GRCm38) L1113* probably null Het
Ryr3 A G 2: 112,775,695 (GRCm38) F2407L probably damaging Het
Sept2 T A 1: 93,497,444 (GRCm38) D107E probably damaging Het
Sept4 A G 11: 87,579,008 (GRCm38) T7A probably benign Het
Slc34a3 T A 2: 25,232,225 (GRCm38) I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 (GRCm38) Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 (GRCm38) E66V probably damaging Het
Spata33 A G 8: 123,213,252 (GRCm38) R68G unknown Het
Spta1 G A 1: 174,202,451 (GRCm38) D928N probably damaging Het
St8sia5 A G 18: 77,254,550 (GRCm38) S319G probably benign Het
Tmem208 A G 8: 105,328,833 (GRCm38) D149G possibly damaging Het
Trank1 A T 9: 111,364,103 (GRCm38) I583F probably damaging Het
Trio C T 15: 27,763,994 (GRCm38) V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 (GRCm38) Q207* probably null Het
Tshr A G 12: 91,505,305 (GRCm38) D143G probably benign Het
Txlna C T 4: 129,632,157 (GRCm38) R299H probably damaging Het
Utp14b A G 1: 78,664,943 (GRCm38) K186R probably damaging Het
Vars2 C T 17: 35,658,158 (GRCm38) A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 (GRCm38) probably benign Het
Zfp775 A G 6: 48,619,249 (GRCm38) Q19R possibly damaging Het
Other mutations in Ush2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ush2a APN 1 188,864,678 (GRCm38) missense probably benign 0.00
IGL00391:Ush2a APN 1 188,916,061 (GRCm38) missense probably damaging 1.00
IGL00429:Ush2a APN 1 188,400,114 (GRCm38) nonsense probably null
IGL00484:Ush2a APN 1 188,782,513 (GRCm38) missense probably benign 0.00
IGL00519:Ush2a APN 1 188,444,668 (GRCm38) missense probably benign 0.03
IGL00567:Ush2a APN 1 188,964,917 (GRCm38) missense probably damaging 1.00
IGL00823:Ush2a APN 1 188,911,443 (GRCm38) missense possibly damaging 0.61
IGL00940:Ush2a APN 1 188,357,961 (GRCm38) nonsense probably null
IGL00951:Ush2a APN 1 188,263,465 (GRCm38) missense probably benign 0.33
IGL00956:Ush2a APN 1 188,753,522 (GRCm38) missense probably damaging 0.99
IGL01096:Ush2a APN 1 188,678,377 (GRCm38) missense probably damaging 1.00
IGL01108:Ush2a APN 1 188,862,825 (GRCm38) missense probably benign 0.00
IGL01315:Ush2a APN 1 188,633,614 (GRCm38) missense possibly damaging 0.51
IGL01318:Ush2a APN 1 188,814,353 (GRCm38) missense probably benign 0.00
IGL01324:Ush2a APN 1 188,848,992 (GRCm38) missense probably benign 0.38
IGL01326:Ush2a APN 1 188,263,321 (GRCm38) nonsense probably null
IGL01384:Ush2a APN 1 188,553,228 (GRCm38) missense possibly damaging 0.65
IGL01466:Ush2a APN 1 188,911,622 (GRCm38) missense probably benign 0.00
IGL01518:Ush2a APN 1 188,399,785 (GRCm38) missense probably benign 0.01
IGL01585:Ush2a APN 1 188,430,727 (GRCm38) missense probably damaging 1.00
IGL01595:Ush2a APN 1 188,654,724 (GRCm38) critical splice donor site probably null
IGL01657:Ush2a APN 1 188,826,461 (GRCm38) missense probably benign 0.03
IGL01797:Ush2a APN 1 188,263,509 (GRCm38) missense probably damaging 1.00
IGL01802:Ush2a APN 1 188,436,957 (GRCm38) missense probably damaging 0.99
IGL01836:Ush2a APN 1 188,759,863 (GRCm38) splice site probably benign
IGL01938:Ush2a APN 1 188,797,845 (GRCm38) missense probably damaging 1.00
IGL01976:Ush2a APN 1 188,911,241 (GRCm38) missense probably benign 0.04
IGL02023:Ush2a APN 1 188,733,514 (GRCm38) missense probably benign 0.03
IGL02126:Ush2a APN 1 188,263,391 (GRCm38) missense probably benign 0.01
IGL02133:Ush2a APN 1 188,443,343 (GRCm38) missense probably damaging 1.00
IGL02147:Ush2a APN 1 188,864,703 (GRCm38) missense probably benign
IGL02275:Ush2a APN 1 188,263,269 (GRCm38) missense possibly damaging 0.67
IGL02314:Ush2a APN 1 188,633,629 (GRCm38) missense probably benign 0.00
IGL02353:Ush2a APN 1 188,728,438 (GRCm38) missense probably benign 0.04
IGL02360:Ush2a APN 1 188,728,438 (GRCm38) missense probably benign 0.04
IGL02367:Ush2a APN 1 188,784,746 (GRCm38) missense probably benign
IGL02402:Ush2a APN 1 188,267,108 (GRCm38) missense probably benign 0.02
IGL02410:Ush2a APN 1 188,915,997 (GRCm38) missense probably damaging 1.00
IGL02490:Ush2a APN 1 188,810,364 (GRCm38) missense probably damaging 1.00
IGL02500:Ush2a APN 1 188,822,696 (GRCm38) missense probably damaging 1.00
IGL02511:Ush2a APN 1 188,743,687 (GRCm38) critical splice donor site probably null
IGL02517:Ush2a APN 1 188,915,998 (GRCm38) missense probably damaging 1.00
IGL02536:Ush2a APN 1 188,957,266 (GRCm38) critical splice acceptor site probably null
IGL02585:Ush2a APN 1 188,728,333 (GRCm38) missense probably benign 0.00
IGL02610:Ush2a APN 1 188,444,466 (GRCm38) missense probably damaging 0.98
IGL02677:Ush2a APN 1 188,734,685 (GRCm38) missense probably damaging 1.00
IGL02691:Ush2a APN 1 188,734,752 (GRCm38) missense probably damaging 1.00
IGL02740:Ush2a APN 1 188,648,388 (GRCm38) missense possibly damaging 0.68
IGL02744:Ush2a APN 1 188,358,717 (GRCm38) splice site probably null
IGL02749:Ush2a APN 1 188,946,958 (GRCm38) missense probably damaging 0.99
IGL02806:Ush2a APN 1 188,810,357 (GRCm38) nonsense probably null
IGL02870:Ush2a APN 1 188,678,358 (GRCm38) missense probably benign 0.42
IGL02894:Ush2a APN 1 188,451,846 (GRCm38) missense probably damaging 1.00
IGL02904:Ush2a APN 1 188,906,506 (GRCm38) missense probably benign 0.06
IGL03000:Ush2a APN 1 188,549,856 (GRCm38) missense possibly damaging 0.81
IGL03015:Ush2a APN 1 188,436,950 (GRCm38) missense probably benign 0.01
IGL03036:Ush2a APN 1 188,864,621 (GRCm38) missense possibly damaging 0.80
IGL03057:Ush2a APN 1 188,797,838 (GRCm38) missense probably damaging 1.00
IGL03230:Ush2a APN 1 188,466,193 (GRCm38) missense probably benign 0.09
IGL03278:Ush2a APN 1 188,849,116 (GRCm38) missense probably damaging 1.00
BB003:Ush2a UTSW 1 188,728,600 (GRCm38) missense probably benign
BB013:Ush2a UTSW 1 188,728,600 (GRCm38) missense probably benign
PIT4283001:Ush2a UTSW 1 188,436,867 (GRCm38) missense probably benign 0.01
R0003:Ush2a UTSW 1 188,578,491 (GRCm38) missense probably damaging 0.99
R0030:Ush2a UTSW 1 188,822,657 (GRCm38) missense possibly damaging 0.51
R0035:Ush2a UTSW 1 188,356,888 (GRCm38) missense probably benign
R0038:Ush2a UTSW 1 188,626,612 (GRCm38) missense probably benign 0.00
R0038:Ush2a UTSW 1 188,626,612 (GRCm38) missense probably benign 0.00
R0067:Ush2a UTSW 1 188,964,846 (GRCm38) missense probably damaging 0.99
R0067:Ush2a UTSW 1 188,964,846 (GRCm38) missense probably damaging 0.99
R0103:Ush2a UTSW 1 188,319,070 (GRCm38) missense possibly damaging 0.81
R0103:Ush2a UTSW 1 188,319,070 (GRCm38) missense possibly damaging 0.81
R0122:Ush2a UTSW 1 188,948,455 (GRCm38) missense possibly damaging 0.65
R0206:Ush2a UTSW 1 188,531,761 (GRCm38) missense probably damaging 0.99
R0208:Ush2a UTSW 1 188,531,761 (GRCm38) missense probably damaging 0.99
R0230:Ush2a UTSW 1 188,850,104 (GRCm38) missense probably damaging 1.00
R0269:Ush2a UTSW 1 188,810,176 (GRCm38) missense probably benign 0.33
R0319:Ush2a UTSW 1 188,948,374 (GRCm38) splice site probably benign
R0358:Ush2a UTSW 1 188,537,780 (GRCm38) missense possibly damaging 0.83
R0379:Ush2a UTSW 1 188,451,819 (GRCm38) missense probably damaging 1.00
R0427:Ush2a UTSW 1 188,400,281 (GRCm38) missense probably damaging 1.00
R0437:Ush2a UTSW 1 188,911,031 (GRCm38) missense probably benign 0.00
R0462:Ush2a UTSW 1 188,910,939 (GRCm38) missense probably benign
R0510:Ush2a UTSW 1 188,734,663 (GRCm38) splice site probably benign
R0531:Ush2a UTSW 1 188,443,181 (GRCm38) missense probably benign 0.18
R0541:Ush2a UTSW 1 188,714,466 (GRCm38) splice site probably benign
R0549:Ush2a UTSW 1 188,946,953 (GRCm38) missense probably damaging 0.99
R0562:Ush2a UTSW 1 188,356,847 (GRCm38) missense probably damaging 1.00
R0636:Ush2a UTSW 1 188,822,738 (GRCm38) missense probably benign
R0662:Ush2a UTSW 1 188,351,093 (GRCm38) missense probably benign 0.26
R0685:Ush2a UTSW 1 188,400,278 (GRCm38) missense probably damaging 1.00
R0718:Ush2a UTSW 1 188,797,830 (GRCm38) missense probably damaging 1.00
R0725:Ush2a UTSW 1 188,951,525 (GRCm38) missense probably damaging 1.00
R0735:Ush2a UTSW 1 188,864,693 (GRCm38) missense probably benign 0.04
R0744:Ush2a UTSW 1 188,814,406 (GRCm38) splice site probably benign
R0765:Ush2a UTSW 1 188,948,574 (GRCm38) missense possibly damaging 0.67
R0862:Ush2a UTSW 1 188,542,818 (GRCm38) nonsense probably null
R1067:Ush2a UTSW 1 188,550,207 (GRCm38) missense probably benign 0.35
R1072:Ush2a UTSW 1 188,728,717 (GRCm38) missense possibly damaging 0.91
R1099:Ush2a UTSW 1 188,864,639 (GRCm38) missense probably damaging 1.00
R1099:Ush2a UTSW 1 188,648,348 (GRCm38) missense probably benign 0.06
R1104:Ush2a UTSW 1 188,916,256 (GRCm38) missense probably benign
R1106:Ush2a UTSW 1 188,910,983 (GRCm38) missense possibly damaging 0.82
R1124:Ush2a UTSW 1 188,753,536 (GRCm38) missense probably damaging 0.99
R1168:Ush2a UTSW 1 188,678,411 (GRCm38) missense probably benign 0.01
R1199:Ush2a UTSW 1 188,759,795 (GRCm38) missense probably benign 0.00
R1215:Ush2a UTSW 1 188,957,282 (GRCm38) missense possibly damaging 0.66
R1307:Ush2a UTSW 1 188,451,840 (GRCm38) missense probably damaging 1.00
R1307:Ush2a UTSW 1 188,357,967 (GRCm38) missense probably damaging 1.00
R1311:Ush2a UTSW 1 188,947,145 (GRCm38) missense possibly damaging 0.86
R1388:Ush2a UTSW 1 188,523,318 (GRCm38) splice site probably benign
R1416:Ush2a UTSW 1 188,436,883 (GRCm38) missense probably damaging 1.00
R1424:Ush2a UTSW 1 188,542,878 (GRCm38) critical splice donor site probably null
R1459:Ush2a UTSW 1 188,862,851 (GRCm38) missense probably benign 0.05
R1470:Ush2a UTSW 1 188,400,206 (GRCm38) missense probably benign 0.00
R1470:Ush2a UTSW 1 188,400,206 (GRCm38) missense probably benign 0.00
R1477:Ush2a UTSW 1 188,849,076 (GRCm38) missense probably benign 0.05
R1484:Ush2a UTSW 1 188,810,337 (GRCm38) nonsense probably null
R1490:Ush2a UTSW 1 188,359,841 (GRCm38) missense probably benign 0.24
R1510:Ush2a UTSW 1 188,648,304 (GRCm38) missense probably damaging 1.00
R1522:Ush2a UTSW 1 188,797,814 (GRCm38) missense possibly damaging 0.94
R1606:Ush2a UTSW 1 188,759,766 (GRCm38) missense probably benign 0.17
R1618:Ush2a UTSW 1 188,814,224 (GRCm38) missense probably benign 0.29
R1636:Ush2a UTSW 1 188,466,176 (GRCm38) missense possibly damaging 0.53
R1646:Ush2a UTSW 1 188,415,821 (GRCm38) missense probably damaging 1.00
R1660:Ush2a UTSW 1 188,916,064 (GRCm38) missense probably benign
R1676:Ush2a UTSW 1 188,728,585 (GRCm38) missense probably damaging 1.00
R1704:Ush2a UTSW 1 188,821,796 (GRCm38) missense probably damaging 1.00
R1705:Ush2a UTSW 1 188,911,541 (GRCm38) missense probably benign 0.40
R1705:Ush2a UTSW 1 188,874,869 (GRCm38) missense probably damaging 1.00
R1760:Ush2a UTSW 1 188,910,983 (GRCm38) missense possibly damaging 0.82
R1776:Ush2a UTSW 1 188,728,203 (GRCm38) missense possibly damaging 0.83
R1782:Ush2a UTSW 1 188,911,185 (GRCm38) missense probably benign 0.06
R1794:Ush2a UTSW 1 188,862,809 (GRCm38) missense probably benign 0.00
R1796:Ush2a UTSW 1 188,910,827 (GRCm38) missense probably benign 0.11
R1804:Ush2a UTSW 1 188,633,729 (GRCm38) critical splice donor site probably null
R1835:Ush2a UTSW 1 188,451,818 (GRCm38) missense probably benign 0.13
R1871:Ush2a UTSW 1 188,826,468 (GRCm38) missense probably benign 0.02
R1876:Ush2a UTSW 1 188,678,289 (GRCm38) missense possibly damaging 0.51
R1887:Ush2a UTSW 1 188,399,980 (GRCm38) missense probably benign 0.05
R1896:Ush2a UTSW 1 188,550,009 (GRCm38) missense probably benign 0.00
R1907:Ush2a UTSW 1 188,715,064 (GRCm38) missense probably benign 0.01
R1940:Ush2a UTSW 1 188,951,561 (GRCm38) missense probably null 0.89
R1950:Ush2a UTSW 1 188,755,185 (GRCm38) missense probably damaging 1.00
R1991:Ush2a UTSW 1 188,578,532 (GRCm38) splice site probably benign
R2043:Ush2a UTSW 1 188,916,256 (GRCm38) missense probably benign 0.00
R2046:Ush2a UTSW 1 188,356,927 (GRCm38) missense probably benign 0.01
R2059:Ush2a UTSW 1 188,381,549 (GRCm38) critical splice donor site probably null
R2239:Ush2a UTSW 1 188,576,214 (GRCm38) missense probably benign
R2365:Ush2a UTSW 1 188,378,991 (GRCm38) missense possibly damaging 0.68
R2395:Ush2a UTSW 1 188,947,040 (GRCm38) missense probably damaging 1.00
R2425:Ush2a UTSW 1 188,537,804 (GRCm38) missense possibly damaging 0.82
R2519:Ush2a UTSW 1 188,267,107 (GRCm38) missense probably benign
R3039:Ush2a UTSW 1 188,911,547 (GRCm38) missense probably damaging 0.99
R3434:Ush2a UTSW 1 188,733,758 (GRCm38) missense probably damaging 1.00
R3711:Ush2a UTSW 1 188,810,292 (GRCm38) missense probably benign 0.05
R3712:Ush2a UTSW 1 188,810,292 (GRCm38) missense probably benign 0.05
R3732:Ush2a UTSW 1 188,944,760 (GRCm38) missense probably benign 0.16
R3746:Ush2a UTSW 1 188,810,292 (GRCm38) missense probably benign 0.05
R3747:Ush2a UTSW 1 188,810,292 (GRCm38) missense probably benign 0.05
R3883:Ush2a UTSW 1 188,263,382 (GRCm38) missense probably benign
R3911:Ush2a UTSW 1 188,399,954 (GRCm38) missense probably benign 0.05
R3934:Ush2a UTSW 1 188,263,511 (GRCm38) critical splice donor site probably null
R3946:Ush2a UTSW 1 188,728,504 (GRCm38) missense probably benign 0.01
R3974:Ush2a UTSW 1 188,381,501 (GRCm38) missense probably benign 0.06
R4158:Ush2a UTSW 1 188,728,710 (GRCm38) missense probably damaging 1.00
R4159:Ush2a UTSW 1 188,728,710 (GRCm38) missense probably damaging 1.00
R4161:Ush2a UTSW 1 188,728,710 (GRCm38) missense probably damaging 1.00
R4162:Ush2a UTSW 1 188,743,680 (GRCm38) missense probably benign 0.00
R4255:Ush2a UTSW 1 188,759,843 (GRCm38) nonsense probably null
R4280:Ush2a UTSW 1 188,578,461 (GRCm38) missense probably benign 0.16
R4387:Ush2a UTSW 1 188,443,431 (GRCm38) missense probably benign 0.00
R4416:Ush2a UTSW 1 188,356,874 (GRCm38) missense probably damaging 0.97
R4494:Ush2a UTSW 1 188,553,276 (GRCm38) missense possibly damaging 0.50
R4505:Ush2a UTSW 1 188,728,596 (GRCm38) missense possibly damaging 0.92
R4522:Ush2a UTSW 1 188,864,625 (GRCm38) missense probably damaging 1.00
R4584:Ush2a UTSW 1 188,451,798 (GRCm38) missense probably benign 0.00
R4599:Ush2a UTSW 1 188,911,647 (GRCm38) missense probably benign 0.01
R4605:Ush2a UTSW 1 188,910,801 (GRCm38) missense probably damaging 1.00
R4632:Ush2a UTSW 1 188,395,874 (GRCm38) missense possibly damaging 0.82
R4688:Ush2a UTSW 1 188,399,941 (GRCm38) missense probably benign 0.01
R4751:Ush2a UTSW 1 188,850,087 (GRCm38) missense probably damaging 0.98
R4770:Ush2a UTSW 1 188,549,879 (GRCm38) missense probably benign 0.25
R4771:Ush2a UTSW 1 188,797,769 (GRCm38) missense possibly damaging 0.92
R4798:Ush2a UTSW 1 188,743,545 (GRCm38) missense probably damaging 1.00
R4821:Ush2a UTSW 1 188,753,651 (GRCm38) missense probably benign 0.32
R4857:Ush2a UTSW 1 188,537,720 (GRCm38) missense probably benign 0.01
R4860:Ush2a UTSW 1 188,553,275 (GRCm38) missense probably benign 0.07
R4860:Ush2a UTSW 1 188,553,275 (GRCm38) missense probably benign 0.07
R4898:Ush2a UTSW 1 188,626,608 (GRCm38) missense probably benign 0.37
R4993:Ush2a UTSW 1 188,910,720 (GRCm38) missense probably benign 0.03
R5035:Ush2a UTSW 1 188,910,808 (GRCm38) missense probably damaging 1.00
R5061:Ush2a UTSW 1 188,957,274 (GRCm38) missense probably benign 0.03
R5150:Ush2a UTSW 1 188,451,870 (GRCm38) missense possibly damaging 0.95
R5205:Ush2a UTSW 1 188,874,936 (GRCm38) missense probably benign 0.21
R5212:Ush2a UTSW 1 188,444,705 (GRCm38) critical splice donor site probably null
R5252:Ush2a UTSW 1 188,821,717 (GRCm38) missense possibly damaging 0.83
R5260:Ush2a UTSW 1 188,947,079 (GRCm38) missense possibly damaging 0.95
R5304:Ush2a UTSW 1 188,356,798 (GRCm38) missense probably damaging 0.99
R5323:Ush2a UTSW 1 188,821,677 (GRCm38) critical splice acceptor site probably null
R5330:Ush2a UTSW 1 188,728,381 (GRCm38) missense probably benign 0.00
R5331:Ush2a UTSW 1 188,728,381 (GRCm38) missense probably benign 0.00
R5332:Ush2a UTSW 1 188,351,079 (GRCm38) missense probably damaging 1.00
R5371:Ush2a UTSW 1 188,443,070 (GRCm38) missense probably benign 0.00
R5374:Ush2a UTSW 1 188,755,206 (GRCm38) missense probably benign
R5377:Ush2a UTSW 1 188,912,123 (GRCm38) missense probably benign 0.00
R5525:Ush2a UTSW 1 188,753,606 (GRCm38) missense probably benign 0.01
R5558:Ush2a UTSW 1 188,797,827 (GRCm38) missense possibly damaging 0.47
R5562:Ush2a UTSW 1 188,576,217 (GRCm38) missense probably damaging 1.00
R5595:Ush2a UTSW 1 188,906,498 (GRCm38) missense possibly damaging 0.95
R5620:Ush2a UTSW 1 188,759,823 (GRCm38) missense possibly damaging 0.82
R5714:Ush2a UTSW 1 188,400,257 (GRCm38) missense probably benign 0.00
R5743:Ush2a UTSW 1 188,436,962 (GRCm38) missense probably benign 0.01
R5779:Ush2a UTSW 1 188,443,510 (GRCm38) critical splice donor site probably null
R5795:Ush2a UTSW 1 188,443,397 (GRCm38) missense probably benign 0.34
R5897:Ush2a UTSW 1 188,821,738 (GRCm38) missense probably damaging 1.00
R5918:Ush2a UTSW 1 188,356,814 (GRCm38) missense probably benign 0.26
R6000:Ush2a UTSW 1 188,267,026 (GRCm38) nonsense probably null
R6014:Ush2a UTSW 1 188,850,040 (GRCm38) missense probably damaging 0.98
R6017:Ush2a UTSW 1 188,957,514 (GRCm38) critical splice donor site probably null
R6020:Ush2a UTSW 1 188,728,096 (GRCm38) splice site probably null
R6039:Ush2a UTSW 1 188,319,020 (GRCm38) missense possibly damaging 0.76
R6039:Ush2a UTSW 1 188,319,020 (GRCm38) missense possibly damaging 0.76
R6050:Ush2a UTSW 1 188,957,324 (GRCm38) missense probably benign 0.06
R6083:Ush2a UTSW 1 188,267,023 (GRCm38) missense probably damaging 1.00
R6091:Ush2a UTSW 1 188,399,803 (GRCm38) missense probably damaging 1.00
R6120:Ush2a UTSW 1 188,358,603 (GRCm38) missense probably benign 0.04
R6135:Ush2a UTSW 1 188,912,106 (GRCm38) missense possibly damaging 0.68
R6141:Ush2a UTSW 1 188,357,963 (GRCm38) missense possibly damaging 0.71
R6157:Ush2a UTSW 1 188,728,270 (GRCm38) missense probably benign 0.00
R6180:Ush2a UTSW 1 188,399,871 (GRCm38) nonsense probably null
R6191:Ush2a UTSW 1 188,263,101 (GRCm38) nonsense probably null
R6217:Ush2a UTSW 1 188,743,454 (GRCm38) splice site probably null
R6263:Ush2a UTSW 1 188,358,642 (GRCm38) missense probably damaging 1.00
R6294:Ush2a UTSW 1 188,536,370 (GRCm38) missense possibly damaging 0.49
R6320:Ush2a UTSW 1 188,356,846 (GRCm38) missense probably benign 0.01
R6321:Ush2a UTSW 1 188,849,046 (GRCm38) nonsense probably null
R6347:Ush2a UTSW 1 188,910,887 (GRCm38) missense probably benign
R6382:Ush2a UTSW 1 188,814,302 (GRCm38) missense probably benign 0.01
R6408:Ush2a UTSW 1 188,267,032 (GRCm38) nonsense probably null
R6418:Ush2a UTSW 1 188,628,566 (GRCm38) missense probably damaging 1.00
R6500:Ush2a UTSW 1 188,841,527 (GRCm38) missense probably benign 0.00
R6504:Ush2a UTSW 1 188,911,247 (GRCm38) missense probably benign 0.00
R6534:Ush2a UTSW 1 188,451,802 (GRCm38) nonsense probably null
R6594:Ush2a UTSW 1 188,910,798 (GRCm38) missense possibly damaging 0.93
R6612:Ush2a UTSW 1 188,911,397 (GRCm38) missense possibly damaging 0.91
R6645:Ush2a UTSW 1 188,523,331 (GRCm38) missense probably damaging 0.99
R6658:Ush2a UTSW 1 188,814,359 (GRCm38) missense possibly damaging 0.95
R6726:Ush2a UTSW 1 188,753,684 (GRCm38) missense possibly damaging 0.85
R6755:Ush2a UTSW 1 188,443,219 (GRCm38) missense possibly damaging 0.95
R6782:Ush2a UTSW 1 188,356,834 (GRCm38) missense probably benign
R6817:Ush2a UTSW 1 188,862,864 (GRCm38) missense probably benign 0.03
R6834:Ush2a UTSW 1 188,356,792 (GRCm38) missense probably damaging 1.00
R6851:Ush2a UTSW 1 188,533,205 (GRCm38) missense probably benign 0.06
R6853:Ush2a UTSW 1 188,911,237 (GRCm38) nonsense probably null
R6867:Ush2a UTSW 1 188,910,973 (GRCm38) missense probably damaging 1.00
R6889:Ush2a UTSW 1 188,797,871 (GRCm38) missense probably damaging 1.00
R6931:Ush2a UTSW 1 188,728,383 (GRCm38) missense probably benign 0.01
R6953:Ush2a UTSW 1 188,263,145 (GRCm38) missense possibly damaging 0.94
R6966:Ush2a UTSW 1 188,576,244 (GRCm38) missense probably damaging 1.00
R7109:Ush2a UTSW 1 188,381,484 (GRCm38) missense probably benign 0.19
R7153:Ush2a UTSW 1 188,728,484 (GRCm38) missense possibly damaging 0.93
R7176:Ush2a UTSW 1 188,537,728 (GRCm38) missense probably benign 0.00
R7182:Ush2a UTSW 1 188,753,543 (GRCm38) missense probably benign 0.01
R7201:Ush2a UTSW 1 188,874,754 (GRCm38) missense probably benign
R7223:Ush2a UTSW 1 188,810,217 (GRCm38) missense probably benign 0.09
R7231:Ush2a UTSW 1 188,759,763 (GRCm38) missense possibly damaging 0.49
R7240:Ush2a UTSW 1 188,911,661 (GRCm38) missense possibly damaging 0.83
R7263:Ush2a UTSW 1 188,443,329 (GRCm38) missense possibly damaging 0.94
R7329:Ush2a UTSW 1 188,553,198 (GRCm38) missense probably damaging 0.97
R7343:Ush2a UTSW 1 188,415,746 (GRCm38) missense probably benign 0.00
R7352:Ush2a UTSW 1 188,466,124 (GRCm38) missense probably benign 0.04
R7384:Ush2a UTSW 1 188,400,163 (GRCm38) missense probably damaging 0.99
R7391:Ush2a UTSW 1 188,962,008 (GRCm38) small deletion probably benign
R7394:Ush2a UTSW 1 188,911,416 (GRCm38) missense possibly damaging 0.83
R7403:Ush2a UTSW 1 188,633,727 (GRCm38) missense probably damaging 1.00
R7408:Ush2a UTSW 1 188,733,529 (GRCm38) missense probably benign 0.00
R7453:Ush2a UTSW 1 188,553,111 (GRCm38) missense probably damaging 1.00
R7496:Ush2a UTSW 1 188,351,087 (GRCm38) missense possibly damaging 0.50
R7552:Ush2a UTSW 1 188,267,044 (GRCm38) missense possibly damaging 0.65
R7556:Ush2a UTSW 1 188,957,493 (GRCm38) missense probably benign 0.31
R7575:Ush2a UTSW 1 188,822,688 (GRCm38) missense possibly damaging 0.90
R7578:Ush2a UTSW 1 188,549,913 (GRCm38) missense probably damaging 1.00
R7584:Ush2a UTSW 1 188,728,109 (GRCm38) critical splice acceptor site probably null
R7589:Ush2a UTSW 1 188,542,849 (GRCm38) missense probably benign 0.00
R7602:Ush2a UTSW 1 188,648,409 (GRCm38) missense probably damaging 1.00
R7670:Ush2a UTSW 1 188,784,708 (GRCm38) missense possibly damaging 0.78
R7743:Ush2a UTSW 1 188,810,179 (GRCm38) missense probably benign 0.05
R7753:Ush2a UTSW 1 188,443,406 (GRCm38) missense probably benign 0.28
R7767:Ush2a UTSW 1 188,553,260 (GRCm38) missense probably benign 0.01
R7831:Ush2a UTSW 1 188,759,841 (GRCm38) missense probably damaging 0.98
R7834:Ush2a UTSW 1 188,733,440 (GRCm38) nonsense probably null
R7847:Ush2a UTSW 1 188,430,808 (GRCm38) missense probably damaging 1.00
R7926:Ush2a UTSW 1 188,728,600 (GRCm38) missense probably benign
R7969:Ush2a UTSW 1 188,826,371 (GRCm38) missense probably benign 0.02
R7978:Ush2a UTSW 1 188,399,938 (GRCm38) missense probably benign 0.00
R7990:Ush2a UTSW 1 188,542,799 (GRCm38) missense probably benign 0.00
R8001:Ush2a UTSW 1 188,911,064 (GRCm38) missense probably damaging 0.98
R8039:Ush2a UTSW 1 188,957,373 (GRCm38) missense probably damaging 1.00
R8077:Ush2a UTSW 1 188,542,828 (GRCm38) missense probably benign 0.01
R8165:Ush2a UTSW 1 188,451,755 (GRCm38) missense possibly damaging 0.70
R8208:Ush2a UTSW 1 188,874,793 (GRCm38) missense possibly damaging 0.95
R8220:Ush2a UTSW 1 188,728,666 (GRCm38) missense probably damaging 1.00
R8270:Ush2a UTSW 1 188,444,641 (GRCm38) missense probably benign 0.06
R8316:Ush2a UTSW 1 188,446,702 (GRCm38) missense probably benign 0.01
R8347:Ush2a UTSW 1 188,947,084 (GRCm38) missense probably benign 0.02
R8360:Ush2a UTSW 1 188,466,271 (GRCm38) missense probably benign 0.01
R8362:Ush2a UTSW 1 188,957,453 (GRCm38) missense probably damaging 0.96
R8386:Ush2a UTSW 1 188,728,206 (GRCm38) missense possibly damaging 0.80
R8401:Ush2a UTSW 1 188,542,865 (GRCm38) missense probably benign 0.10
R8439:Ush2a UTSW 1 188,850,057 (GRCm38) missense probably damaging 1.00
R8465:Ush2a UTSW 1 188,415,678 (GRCm38) missense probably damaging 1.00
R8478:Ush2a UTSW 1 188,443,232 (GRCm38) missense possibly damaging 0.83
R8540:Ush2a UTSW 1 188,542,661 (GRCm38) missense probably benign 0.00
R8684:Ush2a UTSW 1 188,911,023 (GRCm38) missense possibly damaging 0.45
R8685:Ush2a UTSW 1 188,466,204 (GRCm38) missense probably damaging 1.00
R8699:Ush2a UTSW 1 188,911,377 (GRCm38) missense probably damaging 1.00
R8720:Ush2a UTSW 1 188,358,518 (GRCm38) missense probably benign 0.05
R8754:Ush2a UTSW 1 188,848,965 (GRCm38) nonsense probably null
R8756:Ush2a UTSW 1 188,911,944 (GRCm38) missense possibly damaging 0.91
R8788:Ush2a UTSW 1 188,743,619 (GRCm38) nonsense probably null
R8803:Ush2a UTSW 1 188,944,801 (GRCm38) missense probably benign
R8817:Ush2a UTSW 1 188,263,034 (GRCm38) start codon destroyed probably benign 0.00
R8837:Ush2a UTSW 1 188,753,650 (GRCm38) missense probably benign
R8880:Ush2a UTSW 1 188,728,536 (GRCm38) missense probably benign 0.11
R8902:Ush2a UTSW 1 188,443,084 (GRCm38) missense probably damaging 0.98
R8918:Ush2a UTSW 1 188,537,820 (GRCm38) missense possibly damaging 0.85
R8940:Ush2a UTSW 1 188,400,308 (GRCm38) missense probably benign 0.02
R8968:Ush2a UTSW 1 188,395,759 (GRCm38) missense probably damaging 1.00
R8995:Ush2a UTSW 1 188,444,653 (GRCm38) missense probably damaging 0.98
R9011:Ush2a UTSW 1 188,906,479 (GRCm38) missense probably damaging 0.99
R9037:Ush2a UTSW 1 188,263,290 (GRCm38) missense possibly damaging 0.51
R9063:Ush2a UTSW 1 188,263,260 (GRCm38) missense probably benign 0.00
R9089:Ush2a UTSW 1 188,755,177 (GRCm38) nonsense probably null
R9096:Ush2a UTSW 1 188,466,136 (GRCm38) missense probably benign 0.00
R9118:Ush2a UTSW 1 188,654,642 (GRCm38) missense probably damaging 0.98
R9174:Ush2a UTSW 1 188,728,219 (GRCm38) missense probably damaging 0.99
R9210:Ush2a UTSW 1 188,784,669 (GRCm38) missense probably null 0.01
R9242:Ush2a UTSW 1 188,633,590 (GRCm38) missense probably damaging 1.00
R9321:Ush2a UTSW 1 188,356,951 (GRCm38) missense probably damaging 0.97
R9338:Ush2a UTSW 1 188,576,292 (GRCm38) critical splice donor site probably null
R9357:Ush2a UTSW 1 188,874,950 (GRCm38) missense probably benign 0.01
R9358:Ush2a UTSW 1 188,874,950 (GRCm38) missense probably benign 0.01
R9406:Ush2a UTSW 1 188,263,449 (GRCm38) missense probably benign 0.00
R9407:Ush2a UTSW 1 188,911,848 (GRCm38) missense probably damaging 1.00
R9428:Ush2a UTSW 1 188,443,119 (GRCm38) missense probably damaging 1.00
R9456:Ush2a UTSW 1 188,826,392 (GRCm38) missense probably benign 0.00
R9507:Ush2a UTSW 1 188,864,740 (GRCm38) nonsense probably null
R9509:Ush2a UTSW 1 188,916,243 (GRCm38) missense probably damaging 1.00
R9512:Ush2a UTSW 1 188,910,963 (GRCm38) missense probably damaging 0.99
R9564:Ush2a UTSW 1 188,536,354 (GRCm38) missense possibly damaging 0.90
R9612:Ush2a UTSW 1 188,359,866 (GRCm38) nonsense probably null
R9670:Ush2a UTSW 1 188,628,571 (GRCm38) missense probably benign 0.03
R9684:Ush2a UTSW 1 188,399,881 (GRCm38) missense possibly damaging 0.67
R9798:Ush2a UTSW 1 188,911,805 (GRCm38) missense possibly damaging 0.80
RF017:Ush2a UTSW 1 188,263,469 (GRCm38) missense probably damaging 1.00
U24488:Ush2a UTSW 1 188,430,766 (GRCm38) missense probably damaging 0.99
X0011:Ush2a UTSW 1 188,318,969 (GRCm38) missense probably benign 0.00
X0024:Ush2a UTSW 1 188,400,282 (GRCm38) missense probably damaging 1.00
X0026:Ush2a UTSW 1 188,319,025 (GRCm38) missense possibly damaging 0.94
X0062:Ush2a UTSW 1 188,549,854 (GRCm38) missense probably damaging 1.00
Y4340:Ush2a UTSW 1 188,743,629 (GRCm38) missense possibly damaging 0.87
Y4341:Ush2a UTSW 1 188,743,629 (GRCm38) missense possibly damaging 0.87
Z1088:Ush2a UTSW 1 188,947,004 (GRCm38) missense probably benign 0.26
Z1088:Ush2a UTSW 1 188,911,983 (GRCm38) missense probably benign
Z1176:Ush2a UTSW 1 188,356,841 (GRCm38) missense probably damaging 1.00
Z1177:Ush2a UTSW 1 188,912,210 (GRCm38) missense possibly damaging 0.77
Z1177:Ush2a UTSW 1 188,733,544 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGAAAAGTGAGTAGCCTTAAAC -3'
(R):5'- GACCTTAATTTCCAGGCAGCAC -3'

Sequencing Primer
(F):5'- AGTACCTAGTAGCCCTTTGACTTGG -3'
(R):5'- CAGGCAGCACTTTCGTTGAGAG -3'
Posted On 2019-11-26