Incidental Mutation 'R7784:Slc34a3'
ID 599423
Institutional Source Beutler Lab
Gene Symbol Slc34a3
Ensembl Gene ENSMUSG00000006469
Gene Name solute carrier family 34 (sodium phosphate), member 3
Synonyms NPTIIc, Npt2c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 25228898-25234364 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25232225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 123 (I123F)
Ref Sequence ENSEMBL: ENSMUSP00000006638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000091318] [ENSMUST00000205192]
AlphaFold Q80SU6
Predicted Effect probably damaging
Transcript: ENSMUST00000006638
AA Change: I123F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469
AA Change: I123F

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091318
SMART Domains Protein: ENSMUSP00000088868
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091318
SMART Domains Protein: ENSMUSP00000145470
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205192
SMART Domains Protein: ENSMUSP00000145127
Gene: ENSMUSG00000089953

DomainStartEndE-ValueType
RING 23 69 8.23e-6 SMART
low complexity region 137 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypercalciuria, hypercalcemia and increased plasma 1,25(OH)2D3 levels but do not develop hypophosphatemia, renal calcification, rickets, or osteomalacia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Slc34a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Slc34a3 APN 2 25232263 missense probably benign 0.01
IGL02885:Slc34a3 APN 2 25231057 missense probably damaging 1.00
IGL03131:Slc34a3 APN 2 25231234 missense probably benign
IGL03166:Slc34a3 APN 2 25232174 missense probably damaging 0.99
IGL03278:Slc34a3 APN 2 25232047 missense probably benign 0.01
PIT4544001:Slc34a3 UTSW 2 25230595 missense probably benign 0.27
R0415:Slc34a3 UTSW 2 25229110 missense probably benign
R0558:Slc34a3 UTSW 2 25233065 unclassified probably benign
R0883:Slc34a3 UTSW 2 25231233 missense probably benign
R2107:Slc34a3 UTSW 2 25230987 missense probably damaging 0.99
R2329:Slc34a3 UTSW 2 25229410 missense possibly damaging 0.95
R3108:Slc34a3 UTSW 2 25229245 missense probably benign
R4637:Slc34a3 UTSW 2 25229461 missense possibly damaging 0.92
R5008:Slc34a3 UTSW 2 25230842 missense possibly damaging 0.62
R5341:Slc34a3 UTSW 2 25230659 missense probably benign 0.00
R5623:Slc34a3 UTSW 2 25233300 splice site probably null
R6602:Slc34a3 UTSW 2 25229209 missense probably damaging 0.99
R7512:Slc34a3 UTSW 2 25232241 splice site probably null
R8072:Slc34a3 UTSW 2 25229277 missense probably benign 0.01
R8730:Slc34a3 UTSW 2 25232045 missense possibly damaging 0.80
R8762:Slc34a3 UTSW 2 25230991 missense probably benign 0.03
R8880:Slc34a3 UTSW 2 25229255 missense probably benign 0.03
Z1176:Slc34a3 UTSW 2 25229398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGGTGATCGAAGTACC -3'
(R):5'- GCTTTCCAGCTACTAGGCAGTG -3'

Sequencing Primer
(F):5'- CTGGTGATCGAAGTACCCACATTG -3'
(R):5'- ATCTCCCTGTGGGGAATA -3'
Posted On 2019-11-26