Incidental Mutation 'R7784:Rabgap1'
ID 599424
Institutional Source Beutler Lab
Gene Symbol Rabgap1
Ensembl Gene ENSMUSG00000035437
Gene Name RAB GTPase activating protein 1
Synonyms Gapcena
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 37443279-37566454 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37487532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 347 (S347N)
Ref Sequence ENSEMBL: ENSMUSP00000061624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061179] [ENSMUST00000066055] [ENSMUST00000112920] [ENSMUST00000133434] [ENSMUST00000183690]
AlphaFold A2AWA9
Predicted Effect possibly damaging
Transcript: ENSMUST00000061179
AA Change: S347N

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061624
Gene: ENSMUSG00000035437
AA Change: S347N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 1.1e-38 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066055
AA Change: S347N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068835
Gene: ENSMUSG00000035437
AA Change: S347N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 7.1e-39 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112920
AA Change: S347N

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108542
Gene: ENSMUSG00000035437
AA Change: S347N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 432 1.6e-35 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000133434
AA Change: S347N

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121963
Gene: ENSMUSG00000035437
AA Change: S347N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 7.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183690
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Rabgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Rabgap1 APN 2 37469546 missense probably damaging 1.00
IGL01456:Rabgap1 APN 2 37541175 missense probably damaging 0.99
IGL01599:Rabgap1 APN 2 37556269 missense probably damaging 1.00
IGL01834:Rabgap1 APN 2 37564761 intron probably benign
IGL01940:Rabgap1 APN 2 37487067 missense probably damaging 1.00
IGL02416:Rabgap1 APN 2 37561950 missense probably benign 0.00
IGL02683:Rabgap1 APN 2 37502939 missense probably damaging 1.00
IGL02755:Rabgap1 APN 2 37537314 missense probably damaging 0.98
IGL02999:Rabgap1 APN 2 37483826 missense possibly damaging 0.56
IGL03144:Rabgap1 APN 2 37540532 missense probably damaging 0.99
IGL02796:Rabgap1 UTSW 2 37472306 missense probably damaging 0.99
R0117:Rabgap1 UTSW 2 37561885 splice site probably null
R0455:Rabgap1 UTSW 2 37487120 missense probably damaging 1.00
R0569:Rabgap1 UTSW 2 37489717 intron probably benign
R0586:Rabgap1 UTSW 2 37543223 missense probably benign
R0962:Rabgap1 UTSW 2 37560469 intron probably benign
R1055:Rabgap1 UTSW 2 37492068 missense possibly damaging 0.91
R1086:Rabgap1 UTSW 2 37469446 missense probably damaging 0.99
R1251:Rabgap1 UTSW 2 37543234 splice site probably null
R1598:Rabgap1 UTSW 2 37561899 missense probably damaging 1.00
R1924:Rabgap1 UTSW 2 37495759 critical splice donor site probably null
R1957:Rabgap1 UTSW 2 37483762 missense possibly damaging 0.93
R2134:Rabgap1 UTSW 2 37563487 nonsense probably null
R2154:Rabgap1 UTSW 2 37475441 missense probably damaging 1.00
R4328:Rabgap1 UTSW 2 37532615 missense probably damaging 1.00
R4351:Rabgap1 UTSW 2 37483782 missense probably benign
R4658:Rabgap1 UTSW 2 37487549 nonsense probably null
R4821:Rabgap1 UTSW 2 37532519 missense probably damaging 1.00
R4897:Rabgap1 UTSW 2 37560571 missense probably benign 0.01
R5014:Rabgap1 UTSW 2 37487140 missense probably damaging 1.00
R5252:Rabgap1 UTSW 2 37475357 missense probably benign 0.11
R5392:Rabgap1 UTSW 2 37469489 missense probably damaging 1.00
R5794:Rabgap1 UTSW 2 37502902 missense probably benign 0.03
R5941:Rabgap1 UTSW 2 37561896 missense possibly damaging 0.62
R6002:Rabgap1 UTSW 2 37473602 missense probably benign 0.05
R6209:Rabgap1 UTSW 2 37563598 nonsense probably null
R6317:Rabgap1 UTSW 2 37542647 missense possibly damaging 0.88
R7011:Rabgap1 UTSW 2 37540480 missense probably damaging 1.00
R7014:Rabgap1 UTSW 2 37560563 missense probably benign 0.08
R7514:Rabgap1 UTSW 2 37537342 missense probably damaging 1.00
R7543:Rabgap1 UTSW 2 37469432 missense probably damaging 0.99
R7599:Rabgap1 UTSW 2 37502896 frame shift probably null
R7709:Rabgap1 UTSW 2 37537327 missense possibly damaging 0.89
R7816:Rabgap1 UTSW 2 37563464 missense probably benign 0.01
R7834:Rabgap1 UTSW 2 37469407 intron probably benign
R7869:Rabgap1 UTSW 2 37487130 missense probably benign 0.31
R7888:Rabgap1 UTSW 2 37537307 nonsense probably null
R7949:Rabgap1 UTSW 2 37563479 missense probably benign 0.44
R8084:Rabgap1 UTSW 2 37537305 missense probably damaging 1.00
R8333:Rabgap1 UTSW 2 37495698 missense probably benign
R8440:Rabgap1 UTSW 2 37542680 critical splice donor site probably null
R9210:Rabgap1 UTSW 2 37487140 missense probably damaging 0.96
R9212:Rabgap1 UTSW 2 37487140 missense probably damaging 0.96
Z1176:Rabgap1 UTSW 2 37560544 missense probably benign 0.06
Z1177:Rabgap1 UTSW 2 37469528 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCTAACAAAGAACTTGCCATTG -3'
(R):5'- AGACTTGTAACTCCCATGTCCC -3'

Sequencing Primer
(F):5'- CTAACAAAGAACTTGCCATTGAAAGG -3'
(R):5'- GCTTTGTTGCTTACACAAACAC -3'
Posted On 2019-11-26