Mutagenetix > Incidental Mutation

Incidental Mutation 'R7784:Ganc'

599428

Institutional Source

Beutler Lab

Gene Symbol

Ganc

Ensembl Gene

ENSMUSG00000062646

Gene Name

glucosidase, alpha; neutral C

Synonyms

5830445O15Rik

MMRRC Submission

045840-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.730) question?

Stock #

R7784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120403896-120461700 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 120436668 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 488 (W488*)

Ref Sequence

ENSEMBL: ENSMUSP00000116898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000135074]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000135074
AA Change: W488*

SMART Domains

Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: W488*

Domain	Start	End	E-Value	Type
low complexity region	30	44	N/A	INTRINSIC
Pfam:Gal_mutarotas_2	221	292	2.3e-21	PFAM
Pfam:Glyco_hydro_31	333	778	2.5e-137	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	A	T	5: 146,182,828		probably null	Het
3425401B19Rik	A	T	14: 32,659,840	S1389R	probably benign	Het
Abca9	A	T	11: 110,154,417	C363*	probably null	Het
Actbl2	T	A	13: 111,255,411	N93K	probably damaging	Het
Adamtsl3	T	C	7: 82,573,989	Y993H	probably damaging	Het
Adgrg1	G	A	8: 95,012,882	W653*	probably null	Het
Akap13	T	A	7: 75,610,328	V97D	probably benign	Het
C130026I21Rik	T	A	1: 85,212,474		probably null	Het
Cacna1d	T	A	14: 30,123,439	D613V	probably damaging	Het
Col10a1	C	A	10: 34,394,218	P62H	unknown	Het
Cpb2	A	T	14: 75,275,040	N298Y	probably damaging	Het
Ddc	A	G	11: 11,839,396		probably null	Het
Ddx6	T	C	9: 44,630,142		probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Eps8	T	A	6: 137,499,587	I605L	probably benign	Het
Eps8l1	T	C	7: 4,472,122	L304P	probably damaging	Het
Erbb4	T	A	1: 68,075,499	I929F	probably damaging	Het
Erc2	A	T	14: 27,898,594	N393I	probably damaging	Het
Fbxw25	C	T	9: 109,650,119	D355N		Het
Ffar2	T	C	7: 30,819,258	K286E	probably benign	Het
Gabrd	A	G	4: 155,388,932		probably null	Het
Gm5724	C	T	6: 141,713,193		probably null	Het
Ifi207	T	A	1: 173,730,132	M347L	unknown	Het
Kat6b	A	T	14: 21,660,841	I619F	probably damaging	Het
Kif26a	A	G	12: 112,178,147	R1612G	possibly damaging	Het
Kifc3	A	G	8: 95,110,692		probably null	Het
Krt39	A	T	11: 99,521,031	C76*	probably null	Het
Lcmt1	G	T	7: 123,401,495	R84L	probably benign	Het
Lrit1	A	G	14: 37,061,780	Y355C	probably benign	Het
Mad2l1	C	A	6: 66,535,413		probably null	Het
Med23	C	T	10: 24,902,448	T870M	probably damaging	Het
Mrpl2	A	G	17: 46,648,591		probably null	Het
Mtmr6	A	G	14: 60,300,445	D593G	probably benign	Het
Myo15b	G	A	11: 115,861,340	V683M		Het
Neb	T	A	2: 52,235,488	M506L		Het
Olfr103	T	C	17: 37,336,578	Y218C	probably benign	Het
Olfr103	A	G	17: 37,337,055	F59S	probably damaging	Het
Olfr1154	G	A	2: 87,903,193	T161I	probably benign	Het
Olfr434	T	A	6: 43,217,388	H158Q	possibly damaging	Het
Pdzd8	A	G	19: 59,327,863	F294L	probably damaging	Het
Rabgap1	G	A	2: 37,487,532	S347N	possibly damaging	Het
Rasgrf2	T	C	13: 91,896,082	T350A		Het
Rbp3	A	T	14: 33,954,158	H21L	probably benign	Het
Rp1	C	A	1: 4,142,658	V1069F	unknown	Het
Rtn4	T	A	11: 29,741,048	L1113*	probably null	Het
Ryr3	A	G	2: 112,775,695	F2407L	probably damaging	Het
Sept2	T	A	1: 93,497,444	D107E	probably damaging	Het
Sept4	A	G	11: 87,579,008	T7A	probably benign	Het
Slc34a3	T	A	2: 25,232,225	I123F	probably damaging	Het
Slc9a4	T	C	1: 40,600,776	Y243H	probably damaging	Het
Slco1a1	T	A	6: 141,943,388	E66V	probably damaging	Het
Spata33	A	G	8: 123,213,252	R68G	unknown	Het
Spta1	G	A	1: 174,202,451	D928N	probably damaging	Het
St8sia5	A	G	18: 77,254,550	S319G	probably benign	Het
Tmem208	A	G	8: 105,328,833	D149G	possibly damaging	Het
Trank1	A	T	9: 111,364,103	I583F	probably damaging	Het
Trio	C	T	15: 27,763,994	V2015M	probably damaging	Het
Tsc22d1	C	T	14: 76,416,701	Q207*	probably null	Het
Tshr	A	G	12: 91,505,305	D143G	probably benign	Het
Txlna	C	T	4: 129,632,157	R299H	probably damaging	Het
Ush2a	A	T	1: 188,444,592	T1318S	possibly damaging	Het
Utp14b	A	G	1: 78,664,943	K186R	probably damaging	Het
Vars2	C	T	17: 35,658,158	A884T	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp775	A	G	6: 48,619,249	Q19R	possibly damaging	Het

Other mutations in Ganc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Ganc	APN	2	120441598	missense	probably damaging	1.00
IGL00913:Ganc	APN	2	120439452	splice site	probably benign
IGL01077:Ganc	APN	2	120446515	missense	possibly damaging	0.50
IGL01773:Ganc	APN	2	120459884	missense	possibly damaging	0.87
IGL01812:Ganc	APN	2	120411526	missense	probably benign	0.00
IGL02029:Ganc	APN	2	120459857	missense	probably benign	0.00
IGL02067:Ganc	APN	2	120406304	missense	probably benign	0.16
IGL02290:Ganc	APN	2	120448423	missense	possibly damaging	0.90
IGL02355:Ganc	APN	2	120433757	missense	probably damaging	1.00
IGL02362:Ganc	APN	2	120433757	missense	probably damaging	1.00
IGL02553:Ganc	APN	2	120458134	missense	probably benign
IGL02808:Ganc	APN	2	120411511	missense	probably benign	0.00
IGL02966:Ganc	APN	2	120433648	missense	probably damaging	1.00
IGL03356:Ganc	APN	2	120435288	missense	probably benign	0.22
IGL03405:Ganc	APN	2	120433766	missense	probably damaging	1.00
ingenuous	UTSW	2	120444149	missense	probably damaging	1.00
R0464:Ganc	UTSW	2	120436694	missense	probably benign	0.07
R0511:Ganc	UTSW	2	120448401	nonsense	probably null
R0932:Ganc	UTSW	2	120458129	missense	probably damaging	0.99
R1467:Ganc	UTSW	2	120430928	splice site	probably benign
R1902:Ganc	UTSW	2	120446482	missense	probably damaging	1.00
R2087:Ganc	UTSW	2	120457257	missense	probably damaging	1.00
R4668:Ganc	UTSW	2	120431067	missense	probably benign	0.02
R4669:Ganc	UTSW	2	120431067	missense	probably benign	0.02
R4725:Ganc	UTSW	2	120435273	missense	probably damaging	0.99
R4735:Ganc	UTSW	2	120436623	splice site	silent
R4738:Ganc	UTSW	2	120452594	missense	probably damaging	0.97
R4839:Ganc	UTSW	2	120459823	missense	probably benign
R4951:Ganc	UTSW	2	120456047	missense	probably benign	0.00
R5841:Ganc	UTSW	2	120411539	missense	possibly damaging	0.65
R5997:Ganc	UTSW	2	120430605	missense	possibly damaging	0.55
R6142:Ganc	UTSW	2	120430737	critical splice donor site	probably null
R6378:Ganc	UTSW	2	120433826	missense	probably damaging	1.00
R6711:Ganc	UTSW	2	120450839	missense	possibly damaging	0.74
R6777:Ganc	UTSW	2	120444149	missense	probably damaging	1.00
R7229:Ganc	UTSW	2	120427775	missense	possibly damaging	0.92
R7235:Ganc	UTSW	2	120433717	missense	probably damaging	1.00
R7241:Ganc	UTSW	2	120441529	missense	probably damaging	1.00
R7326:Ganc	UTSW	2	120430599	missense	probably damaging	1.00
R7567:Ganc	UTSW	2	120456101	missense	probably benign	0.01
R7685:Ganc	UTSW	2	120433792	missense	probably damaging	1.00
R7736:Ganc	UTSW	2	120433814	missense	possibly damaging	0.83
R7955:Ganc	UTSW	2	120430700	missense	probably damaging	1.00
R8222:Ganc	UTSW	2	120446452	missense	probably damaging	1.00
R8247:Ganc	UTSW	2	120436700	missense	probably null	0.52
R8306:Ganc	UTSW	2	120422079	missense	probably benign	0.02
R9282:Ganc	UTSW	2	120459900	missense	probably benign
X0027:Ganc	UTSW	2	120448450	missense	probably damaging	1.00
Z1177:Ganc	UTSW	2	120433794	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCATGCCTCTCTCAGTTGT -3'
(R):5'- AAGCAACTACCTTTTCCTTTCATTA -3'

Sequencing Primer
(F):5'- AGTTGTCCTTTGTATTTGACATAAGG -3'
(R):5'- TCCATGTAATCCAGCTGTAAGGC -3'

Posted On

2019-11-26