Incidental Mutation 'R7784:Epb42'
ID 599429
Institutional Source Beutler Lab
Gene Symbol Epb42
Ensembl Gene ENSMUSG00000023216
Gene Name erythrocyte membrane protein band 4.2
Synonyms Epb4.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121017891-121037072 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 121034435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 58 (K58N)
Ref Sequence ENSEMBL: ENSMUSP00000099548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023987] [ENSMUST00000102490]
AlphaFold P49222
Predicted Effect possibly damaging
Transcript: ENSMUST00000023987
AA Change: K58N

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023987
Gene: ENSMUSG00000023216
AA Change: K58N

DomainStartEndE-ValueType
Pfam:Transglut_N 5 126 8.9e-35 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 552 5.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102490
AA Change: K58N

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099548
Gene: ENSMUSG00000023216
AA Change: K58N

DomainStartEndE-ValueType
Pfam:Transglut_N 6 124 5.8e-34 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 580 8e-23 PFAM
Pfam:Transglut_C 588 686 8.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is the key component of a macromolecular complex involved in the structure of erythrocytes. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit erythrocytic abnormalities including mild spherocytosis, altered ion transport, and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Epb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Epb42 APN 2 121027688 missense probably damaging 1.00
IGL01627:Epb42 APN 2 121025843 missense probably benign 0.06
IGL02059:Epb42 APN 2 121024707 missense probably damaging 0.96
IGL02869:Epb42 APN 2 121025746 missense probably benign
R0279:Epb42 UTSW 2 121029044 splice site probably benign
R0521:Epb42 UTSW 2 121029150 nonsense probably null
R1457:Epb42 UTSW 2 121029967 critical splice donor site probably null
R2157:Epb42 UTSW 2 121021762 missense probably benign
R2392:Epb42 UTSW 2 121029987 missense possibly damaging 0.85
R2407:Epb42 UTSW 2 121024752 missense probably damaging 1.00
R2866:Epb42 UTSW 2 121025921 missense possibly damaging 0.93
R2993:Epb42 UTSW 2 121029044 splice site probably benign
R3426:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R3427:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R4192:Epb42 UTSW 2 121030089 splice site probably null
R4940:Epb42 UTSW 2 121034451 missense probably damaging 1.00
R5368:Epb42 UTSW 2 121019462 missense probably benign 0.22
R5771:Epb42 UTSW 2 121021820 missense probably damaging 0.99
R6048:Epb42 UTSW 2 121024408 missense probably benign 0.00
R6362:Epb42 UTSW 2 121025779 missense possibly damaging 0.72
R6475:Epb42 UTSW 2 121027133 missense possibly damaging 0.53
R6711:Epb42 UTSW 2 121024108 intron probably benign
R6843:Epb42 UTSW 2 121027685 missense possibly damaging 0.85
R6895:Epb42 UTSW 2 121036623 start gained probably benign
R7154:Epb42 UTSW 2 121033362 missense probably benign 0.01
R7192:Epb42 UTSW 2 121024097 missense unknown
R7600:Epb42 UTSW 2 121021826 missense probably damaging 1.00
R7757:Epb42 UTSW 2 121027719 missense possibly damaging 0.91
R7779:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7781:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7782:Epb42 UTSW 2 121034435 missense probably benign 0.14
R7783:Epb42 UTSW 2 121034435 missense probably benign 0.14
R8737:Epb42 UTSW 2 121025843 missense possibly damaging 0.75
R8915:Epb42 UTSW 2 121019506 missense possibly damaging 0.92
R8930:Epb42 UTSW 2 121024286 missense probably benign 0.00
R8932:Epb42 UTSW 2 121024286 missense probably benign 0.00
Z1177:Epb42 UTSW 2 121027725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCACTCCAGAATCATAATGAAC -3'
(R):5'- TTTGTCCCACAACAGCTCTGAG -3'

Sequencing Primer
(F):5'- CCAGAATCATAATGAACAGCATTTC -3'
(R):5'- CTGAGCATCAAGAGCTGTGACTTC -3'
Posted On 2019-11-26