Mutagenetix > Incidental Mutation

Incidental Mutation 'R7784:Gabrd'

599431

Institutional Source

Beutler Lab

Gene Symbol

Gabrd

Ensembl Gene

ENSMUSG00000029054

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit delta

Synonyms

MMRRC Submission

045840-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R7784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

155384980-155398112 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 155388932 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030925 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030925]

AlphaFold

P22933

Predicted Effect

probably null
Transcript: ENSMUST00000030925

SMART Domains

Protein: ENSMUSP00000030925
Gene: ENSMUSG00000029054

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	43	247	9.8e-48	PFAM
Pfam:Neur_chan_memb	254	402	6.5e-34	PFAM
transmembrane domain	426	448	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129892

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150423

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased postpartum depression and anxiety behaviors, lethality of pups due to materal neglect, and increased cued and contextual conditional freezing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	A	T	5: 146,182,828		probably null	Het
3425401B19Rik	A	T	14: 32,659,840	S1389R	probably benign	Het
Abca9	A	T	11: 110,154,417	C363*	probably null	Het
Actbl2	T	A	13: 111,255,411	N93K	probably damaging	Het
Adamtsl3	T	C	7: 82,573,989	Y993H	probably damaging	Het
Adgrg1	G	A	8: 95,012,882	W653*	probably null	Het
Akap13	T	A	7: 75,610,328	V97D	probably benign	Het
C130026I21Rik	T	A	1: 85,212,474		probably null	Het
Cacna1d	T	A	14: 30,123,439	D613V	probably damaging	Het
Col10a1	C	A	10: 34,394,218	P62H	unknown	Het
Cpb2	A	T	14: 75,275,040	N298Y	probably damaging	Het
Ddc	A	G	11: 11,839,396		probably null	Het
Ddx6	T	C	9: 44,630,142		probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Eps8	T	A	6: 137,499,587	I605L	probably benign	Het
Eps8l1	T	C	7: 4,472,122	L304P	probably damaging	Het
Erbb4	T	A	1: 68,075,499	I929F	probably damaging	Het
Erc2	A	T	14: 27,898,594	N393I	probably damaging	Het
Fbxw25	C	T	9: 109,650,119	D355N		Het
Ffar2	T	C	7: 30,819,258	K286E	probably benign	Het
Ganc	G	A	2: 120,436,668	W488*	probably null	Het
Gm5724	C	T	6: 141,713,193		probably null	Het
Ifi207	T	A	1: 173,730,132	M347L	unknown	Het
Kat6b	A	T	14: 21,660,841	I619F	probably damaging	Het
Kif26a	A	G	12: 112,178,147	R1612G	possibly damaging	Het
Kifc3	A	G	8: 95,110,692		probably null	Het
Krt39	A	T	11: 99,521,031	C76*	probably null	Het
Lcmt1	G	T	7: 123,401,495	R84L	probably benign	Het
Lrit1	A	G	14: 37,061,780	Y355C	probably benign	Het
Mad2l1	C	A	6: 66,535,413		probably null	Het
Med23	C	T	10: 24,902,448	T870M	probably damaging	Het
Mrpl2	A	G	17: 46,648,591		probably null	Het
Mtmr6	A	G	14: 60,300,445	D593G	probably benign	Het
Myo15b	G	A	11: 115,861,340	V683M		Het
Neb	T	A	2: 52,235,488	M506L		Het
Olfr103	T	C	17: 37,336,578	Y218C	probably benign	Het
Olfr103	A	G	17: 37,337,055	F59S	probably damaging	Het
Olfr1154	G	A	2: 87,903,193	T161I	probably benign	Het
Olfr434	T	A	6: 43,217,388	H158Q	possibly damaging	Het
Pdzd8	A	G	19: 59,327,863	F294L	probably damaging	Het
Rabgap1	G	A	2: 37,487,532	S347N	possibly damaging	Het
Rasgrf2	T	C	13: 91,896,082	T350A		Het
Rbp3	A	T	14: 33,954,158	H21L	probably benign	Het
Rp1	C	A	1: 4,142,658	V1069F	unknown	Het
Rtn4	T	A	11: 29,741,048	L1113*	probably null	Het
Ryr3	A	G	2: 112,775,695	F2407L	probably damaging	Het
Sept2	T	A	1: 93,497,444	D107E	probably damaging	Het
Sept4	A	G	11: 87,579,008	T7A	probably benign	Het
Slc34a3	T	A	2: 25,232,225	I123F	probably damaging	Het
Slc9a4	T	C	1: 40,600,776	Y243H	probably damaging	Het
Slco1a1	T	A	6: 141,943,388	E66V	probably damaging	Het
Spata33	A	G	8: 123,213,252	R68G	unknown	Het
Spta1	G	A	1: 174,202,451	D928N	probably damaging	Het
St8sia5	A	G	18: 77,254,550	S319G	probably benign	Het
Tmem208	A	G	8: 105,328,833	D149G	possibly damaging	Het
Trank1	A	T	9: 111,364,103	I583F	probably damaging	Het
Trio	C	T	15: 27,763,994	V2015M	probably damaging	Het
Tsc22d1	C	T	14: 76,416,701	Q207*	probably null	Het
Tshr	A	G	12: 91,505,305	D143G	probably benign	Het
Txlna	C	T	4: 129,632,157	R299H	probably damaging	Het
Ush2a	A	T	1: 188,444,592	T1318S	possibly damaging	Het
Utp14b	A	G	1: 78,664,943	K186R	probably damaging	Het
Vars2	C	T	17: 35,658,158	A884T	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp775	A	G	6: 48,619,249	Q19R	possibly damaging	Het

Other mutations in Gabrd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0006:Gabrd	UTSW	4	155388601	missense	probably damaging	1.00
R0006:Gabrd	UTSW	4	155388601	missense	probably damaging	1.00
R0569:Gabrd	UTSW	4	155385423	missense	probably damaging	1.00
R1826:Gabrd	UTSW	4	155386486	missense	probably damaging	1.00
R4387:Gabrd	UTSW	4	155388932	critical splice donor site	probably null
R5071:Gabrd	UTSW	4	155387162	missense	probably damaging	1.00
R5650:Gabrd	UTSW	4	155388624	missense	probably damaging	1.00
R5818:Gabrd	UTSW	4	155388361	missense	probably damaging	1.00
R6045:Gabrd	UTSW	4	155386474	missense	possibly damaging	0.82
R6301:Gabrd	UTSW	4	155387267	missense	probably damaging	0.96
R7064:Gabrd	UTSW	4	155388346	missense	probably damaging	1.00
R7146:Gabrd	UTSW	4	155385406	missense	probably benign
R7426:Gabrd	UTSW	4	155385513	missense	possibly damaging	0.81
R7451:Gabrd	UTSW	4	155388459	missense	possibly damaging	0.72
R7732:Gabrd	UTSW	4	155385618	missense	probably benign	0.00
R8500:Gabrd	UTSW	4	155385691	missense	probably benign	0.00
R9118:Gabrd	UTSW	4	155386018	missense	possibly damaging	0.51
R9153:Gabrd	UTSW	4	155386039	missense	probably damaging	1.00
R9449:Gabrd	UTSW	4	155388346	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTACATATTTGCCTCAGTGCC -3'
(R):5'- TCCTGTGTCTTGCCTGAAGG -3'

Sequencing Primer
(F):5'- GCCTGGGGAGATACCTCTTTC -3'
(R):5'- TCTTGCCTGAAGGGTCCAGAG -3'

Posted On

2019-11-26