Incidental Mutation 'R7784:Gabrd'
ID 599431
Institutional Source Beutler Lab
Gene Symbol Gabrd
Ensembl Gene ENSMUSG00000029054
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit delta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 155384980-155398112 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 155388932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030925]
AlphaFold P22933
Predicted Effect probably null
Transcript: ENSMUST00000030925
SMART Domains Protein: ENSMUSP00000030925
Gene: ENSMUSG00000029054

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 43 247 9.8e-48 PFAM
Pfam:Neur_chan_memb 254 402 6.5e-34 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150423
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased postpartum depression and anxiety behaviors, lethality of pups due to materal neglect, and increased cued and contextual conditional freezing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Gabrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0006:Gabrd UTSW 4 155388601 missense probably damaging 1.00
R0006:Gabrd UTSW 4 155388601 missense probably damaging 1.00
R0569:Gabrd UTSW 4 155385423 missense probably damaging 1.00
R1826:Gabrd UTSW 4 155386486 missense probably damaging 1.00
R4387:Gabrd UTSW 4 155388932 critical splice donor site probably null
R5071:Gabrd UTSW 4 155387162 missense probably damaging 1.00
R5650:Gabrd UTSW 4 155388624 missense probably damaging 1.00
R5818:Gabrd UTSW 4 155388361 missense probably damaging 1.00
R6045:Gabrd UTSW 4 155386474 missense possibly damaging 0.82
R6301:Gabrd UTSW 4 155387267 missense probably damaging 0.96
R7064:Gabrd UTSW 4 155388346 missense probably damaging 1.00
R7146:Gabrd UTSW 4 155385406 missense probably benign
R7426:Gabrd UTSW 4 155385513 missense possibly damaging 0.81
R7451:Gabrd UTSW 4 155388459 missense possibly damaging 0.72
R7732:Gabrd UTSW 4 155385618 missense probably benign 0.00
R8500:Gabrd UTSW 4 155385691 missense probably benign 0.00
R9118:Gabrd UTSW 4 155386018 missense possibly damaging 0.51
R9153:Gabrd UTSW 4 155386039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTACATATTTGCCTCAGTGCC -3'
(R):5'- TCCTGTGTCTTGCCTGAAGG -3'

Sequencing Primer
(F):5'- GCCTGGGGAGATACCTCTTTC -3'
(R):5'- TCTTGCCTGAAGGGTCCAGAG -3'
Posted On 2019-11-26