Incidental Mutation 'R7784:Eps8'
ID599434
Institutional Source Beutler Lab
Gene Symbol Eps8
Ensembl Gene ENSMUSG00000015766
Gene Nameepidermal growth factor receptor pathway substrate 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R7784 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location137477245-137654876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137499587 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 605 (I605L)
Ref Sequence ENSEMBL: ENSMUSP00000052776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058210] [ENSMUST00000100841] [ENSMUST00000111878] [ENSMUST00000147526]
PDB Structure
THE SH3 DOMAIN OF EPS8 EXISTS AS A NOVEL INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 DOMAIN INTERTWINED DIMER [X-RAY DIFFRACTION]
EPS8 SH3 CLOSED MONOMER [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000058210
AA Change: I605L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000052776
Gene: ENSMUSG00000015766
AA Change: I605L

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000100841
AA Change: I605L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000098402
Gene: ENSMUSG00000015766
AA Change: I605L

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111878
AA Change: I605L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107509
Gene: ENSMUSG00000015766
AA Change: I605L

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000147526
SMART Domains Protein: ENSMUSP00000120044
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 587 4.56e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in resistance to some of the intoxicating effects of ethanol and increased ethanol consumption. NMDA receptor currents and their sensitivity to inhibition by ethanol are abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Eps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Eps8 APN 6 137505479 missense probably benign 0.00
IGL00499:Eps8 APN 6 137522888 nonsense probably null
IGL01587:Eps8 APN 6 137514713 missense probably damaging 1.00
IGL01789:Eps8 APN 6 137539366 missense probably benign 0.01
IGL01836:Eps8 APN 6 137483541 critical splice donor site probably null
IGL01951:Eps8 APN 6 137537671 missense possibly damaging 0.66
IGL02478:Eps8 APN 6 137522842 missense probably benign 0.05
IGL02546:Eps8 APN 6 137479066 missense probably benign 0.30
IGL02861:Eps8 APN 6 137499599 missense probably damaging 1.00
IGL03115:Eps8 APN 6 137527381 missense probably damaging 1.00
IGL03355:Eps8 APN 6 137512145 splice site probably benign
FR4589:Eps8 UTSW 6 137517069 frame shift probably null
R0113:Eps8 UTSW 6 137537684 missense possibly damaging 0.87
R0245:Eps8 UTSW 6 137479128 missense probably benign 0.01
R0462:Eps8 UTSW 6 137514311 missense probably benign 0.00
R0905:Eps8 UTSW 6 137514307 missense probably benign 0.23
R1106:Eps8 UTSW 6 137514324 missense probably damaging 1.00
R1178:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1181:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1448:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1612:Eps8 UTSW 6 137500618 missense probably benign 0.00
R1835:Eps8 UTSW 6 137522279 nonsense probably null
R2068:Eps8 UTSW 6 137522174 missense probably benign 0.13
R2113:Eps8 UTSW 6 137537635 unclassified probably null
R2943:Eps8 UTSW 6 137522872 missense probably damaging 1.00
R3032:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R3879:Eps8 UTSW 6 137527362 splice site probably benign
R3973:Eps8 UTSW 6 137509155 missense probably benign 0.00
R4199:Eps8 UTSW 6 137514327 missense probably damaging 0.96
R4384:Eps8 UTSW 6 137499592 missense probably benign 0.30
R4728:Eps8 UTSW 6 137509162 nonsense probably null
R4840:Eps8 UTSW 6 137527130 missense probably damaging 1.00
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4864:Eps8 UTSW 6 137478969 utr 3 prime probably benign
R5197:Eps8 UTSW 6 137490290 missense probably damaging 0.97
R5197:Eps8 UTSW 6 137490291 missense possibly damaging 0.91
R5214:Eps8 UTSW 6 137527492 missense probably damaging 0.99
R5457:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R5464:Eps8 UTSW 6 137527475 missense probably damaging 1.00
R5557:Eps8 UTSW 6 137479096 missense possibly damaging 0.90
R5981:Eps8 UTSW 6 137482210 missense probably damaging 0.98
R6150:Eps8 UTSW 6 137517174 missense probably damaging 1.00
R6473:Eps8 UTSW 6 137479098 missense probably damaging 1.00
R6529:Eps8 UTSW 6 137514337 missense possibly damaging 0.92
R6574:Eps8 UTSW 6 137483598 nonsense probably null
R6890:Eps8 UTSW 6 137512257 missense probably damaging 0.99
R7180:Eps8 UTSW 6 137479074 missense possibly damaging 0.78
R7229:Eps8 UTSW 6 137539356 missense probably benign
R7314:Eps8 UTSW 6 137527092 missense possibly damaging 0.51
R7336:Eps8 UTSW 6 137509213 missense possibly damaging 0.75
RF025:Eps8 UTSW 6 137517066 critical splice donor site probably benign
RF028:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF035:Eps8 UTSW 6 137517070 frame shift probably null
RF039:Eps8 UTSW 6 137517070 frame shift probably null
RF046:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF057:Eps8 UTSW 6 137517064 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTAACTTATTGCTGGACAC -3'
(R):5'- GTAAAAGTTGACCAGTGCGTG -3'

Sequencing Primer
(F):5'- GCTGGACACTTTAAGAGTTTCTTCAC -3'
(R):5'- ATGGGTTTCCTTATATCGATCGAGTC -3'
Posted On2019-11-26