Mutagenetix > Incidental Mutations

Incidental Mutation 'R7784:Lcmt1'

599441

Institutional Source

Beutler Lab

Gene Symbol

Lcmt1

Ensembl Gene

ENSMUSG00000030763

Gene Name

leucine carboxyl methyltransferase 1

Synonyms

LCMT-1, Lcmt

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123369784-123430358 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 123401495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 84 (R84L)

Ref Sequence

ENSEMBL: ENSMUSP00000033025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033025] [ENSMUST00000206574] [ENSMUST00000206721]

AlphaFold

A0A0U1RNF2

Predicted Effect

probably benign
Transcript: ENSMUST00000033025
AA Change: R84L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000033025
Gene: ENSMUSG00000030763
AA Change: R84L

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:LCM	23	215	3.6e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000206574
AA Change: R84L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000206721

Meta Mutation Damage Score

0.1449

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are embryonic lethal. Mice homozygous for a hypomorphic gene trap allele exhibit partial embryonic lethality, insulin resistance and impaired glucose tolerance. Mice homozygous for a transgenic gene disruption exhibit kidney agenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	A	T	5: 146,182,828		probably null	Het
3425401B19Rik	A	T	14: 32,659,840	S1389R	probably benign	Het
Abca9	A	T	11: 110,154,417	C363*	probably null	Het
Actbl2	T	A	13: 111,255,411	N93K	probably damaging	Het
Adamtsl3	T	C	7: 82,573,989	Y993H	probably damaging	Het
Adgrg1	G	A	8: 95,012,882	W653*	probably null	Het
Akap13	T	A	7: 75,610,328	V97D	probably benign	Het
C130026I21Rik	T	A	1: 85,212,474		probably null	Het
Cacna1d	T	A	14: 30,123,439	D613V	probably damaging	Het
Col10a1	C	A	10: 34,394,218	P62H	unknown	Het
Cpb2	A	T	14: 75,275,040	N298Y	probably damaging	Het
Ddc	A	G	11: 11,839,396		probably null	Het
Ddx6	T	C	9: 44,630,142		probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Eps8	T	A	6: 137,499,587	I605L	probably benign	Het
Eps8l1	T	C	7: 4,472,122	L304P	probably damaging	Het
Erbb4	T	A	1: 68,075,499	I929F	probably damaging	Het
Erc2	A	T	14: 27,898,594	N393I	probably damaging	Het
Fbxw25	C	T	9: 109,650,119	D355N		Het
Ffar2	T	C	7: 30,819,258	K286E	probably benign	Het
Gabrd	A	G	4: 155,388,932		probably null	Het
Ganc	G	A	2: 120,436,668	W488*	probably null	Het
Gm5724	C	T	6: 141,713,193		probably null	Het
Ifi207	T	A	1: 173,730,132	M347L	unknown	Het
Kat6b	A	T	14: 21,660,841	I619F	probably damaging	Het
Kif26a	A	G	12: 112,178,147	R1612G	possibly damaging	Het
Kifc3	A	G	8: 95,110,692		probably null	Het
Krt39	A	T	11: 99,521,031	C76*	probably null	Het
Lrit1	A	G	14: 37,061,780	Y355C	probably benign	Het
Mad2l1	C	A	6: 66,535,413		probably null	Het
Med23	C	T	10: 24,902,448	T870M	probably damaging	Het
Mrpl2	A	G	17: 46,648,591		probably null	Het
Mtmr6	A	G	14: 60,300,445	D593G	probably benign	Het
Myo15b	G	A	11: 115,861,340	V683M		Het
Neb	T	A	2: 52,235,488	M506L		Het
Olfr103	T	C	17: 37,336,578	Y218C	probably benign	Het
Olfr103	A	G	17: 37,337,055	F59S	probably damaging	Het
Olfr1154	G	A	2: 87,903,193	T161I	probably benign	Het
Olfr434	T	A	6: 43,217,388	H158Q	possibly damaging	Het
Pdzd8	A	G	19: 59,327,863	F294L	probably damaging	Het
Rabgap1	G	A	2: 37,487,532	S347N	possibly damaging	Het
Rasgrf2	T	C	13: 91,896,082	T350A		Het
Rbp3	A	T	14: 33,954,158	H21L	probably benign	Het
Rp1	C	A	1: 4,142,658	V1069F	unknown	Het
Rtn4	T	A	11: 29,741,048	L1113*	probably null	Het
Ryr3	A	G	2: 112,775,695	F2407L	probably damaging	Het
Sept2	T	A	1: 93,497,444	D107E	probably damaging	Het
Sept4	A	G	11: 87,579,008	T7A	probably benign	Het
Slc34a3	T	A	2: 25,232,225	I123F	probably damaging	Het
Slc9a4	T	C	1: 40,600,776	Y243H	probably damaging	Het
Slco1a1	T	A	6: 141,943,388	E66V	probably damaging	Het
Spata33	A	G	8: 123,213,252	R68G	unknown	Het
Spta1	G	A	1: 174,202,451	D928N	probably damaging	Het
St8sia5	A	G	18: 77,254,550	S319G	probably benign	Het
Tmem208	A	G	8: 105,328,833	D149G	possibly damaging	Het
Trank1	A	T	9: 111,364,103	I583F	probably damaging	Het
Trio	C	T	15: 27,763,994	V2015M	probably damaging	Het
Tsc22d1	C	T	14: 76,416,701	Q207*	probably null	Het
Tshr	A	G	12: 91,505,305	D143G	probably benign	Het
Txlna	C	T	4: 129,632,157	R299H	probably damaging	Het
Ush2a	A	T	1: 188,444,592	T1318S	possibly damaging	Het
Utp14b	A	G	1: 78,664,943	K186R	probably damaging	Het
Vars2	C	T	17: 35,658,158	A884T	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp775	A	G	6: 48,619,249	Q19R	possibly damaging	Het

Other mutations in Lcmt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Lcmt1	APN	7	123428153	missense	probably damaging	1.00
IGL01536:Lcmt1	APN	7	123422743	missense	possibly damaging	0.46
IGL01564:Lcmt1	APN	7	123404440	missense	probably benign	0.00
IGL02598:Lcmt1	APN	7	123421648	splice site	probably benign
rancho	UTSW	7	123401495	missense	probably benign	0.03
relasso	UTSW	7	123401468	missense	probably damaging	1.00
R0665:Lcmt1	UTSW	7	123402871	missense	probably damaging	1.00
R0668:Lcmt1	UTSW	7	123402871	missense	probably damaging	1.00
R0943:Lcmt1	UTSW	7	123401439	splice site	probably null
R1574:Lcmt1	UTSW	7	123402908	missense	probably damaging	1.00
R1574:Lcmt1	UTSW	7	123402908	missense	probably damaging	1.00
R2896:Lcmt1	UTSW	7	123421586	missense	possibly damaging	0.95
R3017:Lcmt1	UTSW	7	123430136	missense	probably damaging	1.00
R3547:Lcmt1	UTSW	7	123400479	missense	probably benign	0.07
R3714:Lcmt1	UTSW	7	123404460	missense	probably damaging	0.98
R4092:Lcmt1	UTSW	7	123418253	missense	probably damaging	1.00
R4628:Lcmt1	UTSW	7	123410812	nonsense	probably null
R5062:Lcmt1	UTSW	7	123410830	splice site	probably null
R5096:Lcmt1	UTSW	7	123401468	missense	probably damaging	1.00
R5549:Lcmt1	UTSW	7	123428107	missense	probably damaging	1.00
R5573:Lcmt1	UTSW	7	123401463	missense	probably benign	0.03
R5931:Lcmt1	UTSW	7	123421616	missense	probably benign
R6331:Lcmt1	UTSW	7	123378182	intron	probably benign
R7752:Lcmt1	UTSW	7	123369807	missense	unknown
R8447:Lcmt1	UTSW	7	123421602	missense	probably damaging	1.00
R8499:Lcmt1	UTSW	7	123430148	missense	probably benign	0.02
R8743:Lcmt1	UTSW	7	123400468	missense	probably damaging	1.00
R8962:Lcmt1	UTSW	7	123401446	missense	probably damaging	1.00
RF013:Lcmt1	UTSW	7	123369836	frame shift	probably null
RF025:Lcmt1	UTSW	7	123369834	frame shift	probably null
RF046:Lcmt1	UTSW	7	123369834	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ATGAGTAGTGCTGAGCCAGG -3'
(R):5'- ATACAGTACACAGGGTTTTAGGATC -3'

Sequencing Primer
(F):5'- AGGAACCCTTGTGGCACCTTG -3'
(R):5'- GTTAGACTATCAGCTGAGACAGTCC -3'

Posted On

2019-11-26