Incidental Mutation 'R7784:Adgrg1'
ID 599442
Institutional Source Beutler Lab
Gene Symbol Adgrg1
Ensembl Gene ENSMUSG00000031785
Gene Name adhesion G protein-coupled receptor G1
Synonyms Cyt28, Gpr56
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 94974751-95014217 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 95012882 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 653 (W653*)
Ref Sequence ENSEMBL: ENSMUSP00000090959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051259] [ENSMUST00000093271] [ENSMUST00000179619] [ENSMUST00000212660]
AlphaFold Q8K209
Predicted Effect probably benign
Transcript: ENSMUST00000051259
SMART Domains Protein: ENSMUSP00000051079
Gene: ENSMUSG00000060470

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 209 256 3.45e-11 SMART
Pfam:7tm_2 260 509 5.1e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093271
AA Change: W653*
SMART Domains Protein: ENSMUSP00000090959
Gene: ENSMUSG00000031785
AA Change: W653*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 8.1e-32 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179619
AA Change: W653*
SMART Domains Protein: ENSMUSP00000137520
Gene: ENSMUSG00000031785
AA Change: W653*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 3.4e-31 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212660
AA Change: W653*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor family and regulates brain cortical patterning. The encoded protein binds specifically to transglutaminase 2, a component of tissue and tumor stroma implicated as an inhibitor of tumor progression. Mutations in this gene are associated with a brain malformation known as bilateral frontoparietal polymicrogyria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit neuronal ectopias in the frontoparietal cortex due to disruptions in the pial basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Adgrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Adgrg1 APN 8 95005243 missense probably damaging 1.00
IGL01138:Adgrg1 APN 8 95003457 missense probably damaging 1.00
IGL01806:Adgrg1 APN 8 95012931 missense probably damaging 1.00
IGL02229:Adgrg1 APN 8 95003511 missense probably damaging 1.00
IGL03109:Adgrg1 APN 8 95007676 unclassified probably benign
D4043:Adgrg1 UTSW 8 95005229 splice site probably null
R0383:Adgrg1 UTSW 8 95011742 missense probably damaging 1.00
R1155:Adgrg1 UTSW 8 95006840 missense possibly damaging 0.92
R1656:Adgrg1 UTSW 8 95011810 nonsense probably null
R1944:Adgrg1 UTSW 8 95007300 missense probably damaging 0.99
R1952:Adgrg1 UTSW 8 95008491 critical splice donor site probably null
R2408:Adgrg1 UTSW 8 95003493 missense probably null 1.00
R3776:Adgrg1 UTSW 8 95009655 missense probably damaging 0.99
R3813:Adgrg1 UTSW 8 95011565 missense probably benign 0.34
R4254:Adgrg1 UTSW 8 95005902 splice site probably null
R4255:Adgrg1 UTSW 8 95005902 splice site probably null
R4951:Adgrg1 UTSW 8 95005246 missense probably damaging 1.00
R4997:Adgrg1 UTSW 8 95009520 missense probably damaging 1.00
R5152:Adgrg1 UTSW 8 95009745 missense probably damaging 1.00
R6122:Adgrg1 UTSW 8 95002501 missense probably benign 0.45
R6897:Adgrg1 UTSW 8 95002498 missense probably benign
R7446:Adgrg1 UTSW 8 95011784 missense probably damaging 1.00
R7736:Adgrg1 UTSW 8 95005337 missense probably benign
R8187:Adgrg1 UTSW 8 95005818 missense probably benign 0.01
R8425:Adgrg1 UTSW 8 95008407 missense probably damaging 1.00
R8474:Adgrg1 UTSW 8 95003308 missense probably damaging 1.00
R8674:Adgrg1 UTSW 8 95000898 intron probably benign
R8683:Adgrg1 UTSW 8 95009648 missense probably damaging 1.00
Z1177:Adgrg1 UTSW 8 95007630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCATTCCGAGTGGCTC -3'
(R):5'- GGCCTTCTCTAGTATGCCAC -3'

Sequencing Primer
(F):5'- TCCAGAGCCCTGAGTATATGACTG -3'
(R):5'- CACTAACCAACAAAGGCTGGGTG -3'
Posted On 2019-11-26