Incidental Mutation 'R7784:Kifc3'
ID 599443
Institutional Source Beutler Lab
Gene Symbol Kifc3
Ensembl Gene ENSMUSG00000031788
Gene Name kinesin family member C3
Synonyms
MMRRC Submission 045840-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 95099828-95202812 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 95110692 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034240] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000169748] [ENSMUST00000212424] [ENSMUST00000212424] [ENSMUST00000212787] [ENSMUST00000212787] [ENSMUST00000213004] [ENSMUST00000213004]
AlphaFold O35231
Predicted Effect probably null
Transcript: ENSMUST00000034240
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034240
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169353
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169748
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169748
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212424
Predicted Effect probably null
Transcript: ENSMUST00000212424
Predicted Effect probably null
Transcript: ENSMUST00000212787
Predicted Effect probably null
Transcript: ENSMUST00000212787
Predicted Effect probably null
Transcript: ENSMUST00000213004
Predicted Effect probably null
Transcript: ENSMUST00000213004
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 (GRCm38) probably null Het
3425401B19Rik A T 14: 32,659,840 (GRCm38) S1389R probably benign Het
Abca9 A T 11: 110,154,417 (GRCm38) C363* probably null Het
Actbl2 T A 13: 111,255,411 (GRCm38) N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 (GRCm38) Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 (GRCm38) W653* probably null Het
Akap13 T A 7: 75,610,328 (GRCm38) V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 (GRCm38) probably null Het
Cacna1d T A 14: 30,123,439 (GRCm38) D613V probably damaging Het
Col10a1 C A 10: 34,394,218 (GRCm38) P62H unknown Het
Cpb2 A T 14: 75,275,040 (GRCm38) N298Y probably damaging Het
Ddc A G 11: 11,839,396 (GRCm38) probably null Het
Ddx6 T C 9: 44,630,142 (GRCm38) probably null Het
Epb42 T G 2: 121,034,435 (GRCm38) K58N probably benign Het
Eps8 T A 6: 137,499,587 (GRCm38) I605L probably benign Het
Eps8l1 T C 7: 4,472,122 (GRCm38) L304P probably damaging Het
Erbb4 T A 1: 68,075,499 (GRCm38) I929F probably damaging Het
Erc2 A T 14: 27,898,594 (GRCm38) N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 (GRCm38) D355N Het
Ffar2 T C 7: 30,819,258 (GRCm38) K286E probably benign Het
Gabrd A G 4: 155,388,932 (GRCm38) probably null Het
Ganc G A 2: 120,436,668 (GRCm38) W488* probably null Het
Gm5724 C T 6: 141,713,193 (GRCm38) probably null Het
Ifi207 T A 1: 173,730,132 (GRCm38) M347L unknown Het
Kat6b A T 14: 21,660,841 (GRCm38) I619F probably damaging Het
Kif26a A G 12: 112,178,147 (GRCm38) R1612G possibly damaging Het
Krt39 A T 11: 99,521,031 (GRCm38) C76* probably null Het
Lcmt1 G T 7: 123,401,495 (GRCm38) R84L probably benign Het
Lrit1 A G 14: 37,061,780 (GRCm38) Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 (GRCm38) probably null Het
Med23 C T 10: 24,902,448 (GRCm38) T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 (GRCm38) probably null Het
Mtmr6 A G 14: 60,300,445 (GRCm38) D593G probably benign Het
Myo15b G A 11: 115,861,340 (GRCm38) V683M Het
Neb T A 2: 52,235,488 (GRCm38) M506L Het
Olfr103 T C 17: 37,336,578 (GRCm38) Y218C probably benign Het
Olfr103 A G 17: 37,337,055 (GRCm38) F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 (GRCm38) T161I probably benign Het
Olfr434 T A 6: 43,217,388 (GRCm38) H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 (GRCm38) F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 (GRCm38) S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 (GRCm38) T350A Het
Rbp3 A T 14: 33,954,158 (GRCm38) H21L probably benign Het
Rp1 C A 1: 4,142,658 (GRCm38) V1069F unknown Het
Rtn4 T A 11: 29,741,048 (GRCm38) L1113* probably null Het
Ryr3 A G 2: 112,775,695 (GRCm38) F2407L probably damaging Het
Sept2 T A 1: 93,497,444 (GRCm38) D107E probably damaging Het
Sept4 A G 11: 87,579,008 (GRCm38) T7A probably benign Het
Slc34a3 T A 2: 25,232,225 (GRCm38) I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 (GRCm38) Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 (GRCm38) E66V probably damaging Het
Spata33 A G 8: 123,213,252 (GRCm38) R68G unknown Het
Spta1 G A 1: 174,202,451 (GRCm38) D928N probably damaging Het
St8sia5 A G 18: 77,254,550 (GRCm38) S319G probably benign Het
Tmem208 A G 8: 105,328,833 (GRCm38) D149G possibly damaging Het
Trank1 A T 9: 111,364,103 (GRCm38) I583F probably damaging Het
Trio C T 15: 27,763,994 (GRCm38) V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 (GRCm38) Q207* probably null Het
Tshr A G 12: 91,505,305 (GRCm38) D143G probably benign Het
Txlna C T 4: 129,632,157 (GRCm38) R299H probably damaging Het
Ush2a A T 1: 188,444,592 (GRCm38) T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 (GRCm38) K186R probably damaging Het
Vars2 C T 17: 35,658,158 (GRCm38) A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 (GRCm38) probably benign Het
Zfp775 A G 6: 48,619,249 (GRCm38) Q19R possibly damaging Het
Other mutations in Kifc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Kifc3 APN 8 95,138,016 (GRCm38) missense probably damaging 1.00
IGL01904:Kifc3 APN 8 95,137,957 (GRCm38) missense possibly damaging 0.81
IGL02019:Kifc3 APN 8 95,107,540 (GRCm38) splice site probably benign
IGL02090:Kifc3 APN 8 95,102,480 (GRCm38) missense probably damaging 1.00
IGL02355:Kifc3 APN 8 95,109,879 (GRCm38) missense probably damaging 1.00
IGL02362:Kifc3 APN 8 95,109,879 (GRCm38) missense probably damaging 1.00
IGL02620:Kifc3 APN 8 95,109,954 (GRCm38) missense probably damaging 0.98
IGL02720:Kifc3 APN 8 95,108,365 (GRCm38) missense probably benign 0.00
IGL03030:Kifc3 APN 8 95,102,412 (GRCm38) missense probably damaging 1.00
IGL03327:Kifc3 APN 8 95,108,432 (GRCm38) missense probably damaging 1.00
IGL03390:Kifc3 APN 8 95,108,613 (GRCm38) missense probably damaging 1.00
R0233:Kifc3 UTSW 8 95,101,472 (GRCm38) splice site probably null
R0281:Kifc3 UTSW 8 95,103,460 (GRCm38) missense probably damaging 1.00
R0302:Kifc3 UTSW 8 95,103,470 (GRCm38) missense possibly damaging 0.50
R0619:Kifc3 UTSW 8 95,102,665 (GRCm38) missense probably benign 0.13
R0731:Kifc3 UTSW 8 95,105,733 (GRCm38) missense probably damaging 1.00
R1017:Kifc3 UTSW 8 95,105,785 (GRCm38) missense probably damaging 0.99
R1147:Kifc3 UTSW 8 95,137,918 (GRCm38) missense probably damaging 1.00
R1147:Kifc3 UTSW 8 95,137,918 (GRCm38) missense probably damaging 1.00
R1257:Kifc3 UTSW 8 95,105,772 (GRCm38) missense probably damaging 0.98
R1472:Kifc3 UTSW 8 95,137,913 (GRCm38) critical splice donor site probably null
R1480:Kifc3 UTSW 8 95,109,887 (GRCm38) missense probably damaging 1.00
R1553:Kifc3 UTSW 8 95,106,542 (GRCm38) missense possibly damaging 0.67
R2071:Kifc3 UTSW 8 95,108,353 (GRCm38) critical splice donor site probably null
R2115:Kifc3 UTSW 8 95,108,713 (GRCm38) missense probably damaging 1.00
R3703:Kifc3 UTSW 8 95,104,028 (GRCm38) splice site probably benign
R3704:Kifc3 UTSW 8 95,104,028 (GRCm38) splice site probably benign
R3705:Kifc3 UTSW 8 95,104,028 (GRCm38) splice site probably benign
R4223:Kifc3 UTSW 8 95,109,982 (GRCm38) missense probably damaging 0.96
R4463:Kifc3 UTSW 8 95,102,116 (GRCm38) missense probably damaging 1.00
R4508:Kifc3 UTSW 8 95,107,420 (GRCm38) splice site probably null
R4980:Kifc3 UTSW 8 95,126,549 (GRCm38) missense probably benign
R5032:Kifc3 UTSW 8 95,102,726 (GRCm38) missense probably damaging 1.00
R5068:Kifc3 UTSW 8 95,110,216 (GRCm38) missense possibly damaging 0.54
R5421:Kifc3 UTSW 8 95,109,845 (GRCm38) missense probably damaging 0.99
R5556:Kifc3 UTSW 8 95,108,459 (GRCm38) nonsense probably null
R6845:Kifc3 UTSW 8 95,108,679 (GRCm38) missense probably benign 0.28
R7136:Kifc3 UTSW 8 95,103,449 (GRCm38) missense probably benign 0.10
R7196:Kifc3 UTSW 8 95,106,611 (GRCm38) missense probably benign 0.02
R7404:Kifc3 UTSW 8 95,103,464 (GRCm38) missense probably benign 0.02
R7441:Kifc3 UTSW 8 95,137,987 (GRCm38) missense probably benign 0.00
R7861:Kifc3 UTSW 8 95,107,537 (GRCm38) critical splice acceptor site probably null
R8440:Kifc3 UTSW 8 95,109,794 (GRCm38) missense possibly damaging 0.89
R8754:Kifc3 UTSW 8 95,102,396 (GRCm38) missense probably damaging 1.00
R8983:Kifc3 UTSW 8 95,106,476 (GRCm38) missense probably damaging 1.00
R9035:Kifc3 UTSW 8 95,126,567 (GRCm38) missense possibly damaging 0.52
R9149:Kifc3 UTSW 8 95,126,689 (GRCm38) missense probably benign
R9464:Kifc3 UTSW 8 95,103,994 (GRCm38) missense possibly damaging 0.61
R9589:Kifc3 UTSW 8 95,134,744 (GRCm38) missense possibly damaging 0.87
X0023:Kifc3 UTSW 8 95,109,298 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGTCAGCAAATGAGATCCAGC -3'
(R):5'- AGACCAGGCTAGCTTACCAG -3'

Sequencing Primer
(F):5'- ATGAGATCCAGCCCCCTG -3'
(R):5'- AGGCTAGCTTACCAGAGTTCCTG -3'
Posted On 2019-11-26