Mutagenetix > Incidental Mutations

Incidental Mutation 'R7784:Kifc3'

599443

Institutional Source

Beutler Lab

Gene Symbol

Kifc3

Ensembl Gene

ENSMUSG00000031788

Gene Name

kinesin family member C3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95099828-95202812 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 95110692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034240] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000169748] [ENSMUST00000212424] [ENSMUST00000212424] [ENSMUST00000212787] [ENSMUST00000212787] [ENSMUST00000213004] [ENSMUST00000213004]

AlphaFold

O35231

Predicted Effect

probably null
Transcript: ENSMUST00000034240

SMART Domains

Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
low complexity region	33	46	N/A	INTRINSIC
coiled coil region	100	360	N/A	INTRINSIC
coiled coil region	393	430	N/A	INTRINSIC
KISc	441	774	3.15e-158	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000034240

SMART Domains

Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
low complexity region	33	46	N/A	INTRINSIC
coiled coil region	100	360	N/A	INTRINSIC
coiled coil region	393	430	N/A	INTRINSIC
KISc	441	774	3.15e-158	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169353

SMART Domains

Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
coiled coil region	33	223	N/A	INTRINSIC
coiled coil region	256	293	N/A	INTRINSIC
KISc	304	637	3.15e-158	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169748

SMART Domains

Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
coiled coil region	34	324	N/A	INTRINSIC
coiled coil region	357	394	N/A	INTRINSIC
KISc	405	728	3.11e-148	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169748

SMART Domains

Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
coiled coil region	34	324	N/A	INTRINSIC
coiled coil region	357	394	N/A	INTRINSIC
KISc	405	728	3.11e-148	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000212424

Predicted Effect

probably null
Transcript: ENSMUST00000212424

Predicted Effect

probably null
Transcript: ENSMUST00000212787

Predicted Effect

probably null
Transcript: ENSMUST00000212787

Predicted Effect

probably null
Transcript: ENSMUST00000213004

Predicted Effect

probably null
Transcript: ENSMUST00000213004

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	A	T	5: 146,182,828		probably null	Het
3425401B19Rik	A	T	14: 32,659,840	S1389R	probably benign	Het
Abca9	A	T	11: 110,154,417	C363*	probably null	Het
Actbl2	T	A	13: 111,255,411	N93K	probably damaging	Het
Adamtsl3	T	C	7: 82,573,989	Y993H	probably damaging	Het
Adgrg1	G	A	8: 95,012,882	W653*	probably null	Het
Akap13	T	A	7: 75,610,328	V97D	probably benign	Het
C130026I21Rik	T	A	1: 85,212,474		probably null	Het
Cacna1d	T	A	14: 30,123,439	D613V	probably damaging	Het
Col10a1	C	A	10: 34,394,218	P62H	unknown	Het
Cpb2	A	T	14: 75,275,040	N298Y	probably damaging	Het
Ddc	A	G	11: 11,839,396		probably null	Het
Ddx6	T	C	9: 44,630,142		probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Eps8	T	A	6: 137,499,587	I605L	probably benign	Het
Eps8l1	T	C	7: 4,472,122	L304P	probably damaging	Het
Erbb4	T	A	1: 68,075,499	I929F	probably damaging	Het
Erc2	A	T	14: 27,898,594	N393I	probably damaging	Het
Fbxw25	C	T	9: 109,650,119	D355N		Het
Ffar2	T	C	7: 30,819,258	K286E	probably benign	Het
Gabrd	A	G	4: 155,388,932		probably null	Het
Ganc	G	A	2: 120,436,668	W488*	probably null	Het
Gm5724	C	T	6: 141,713,193		probably null	Het
Ifi207	T	A	1: 173,730,132	M347L	unknown	Het
Kat6b	A	T	14: 21,660,841	I619F	probably damaging	Het
Kif26a	A	G	12: 112,178,147	R1612G	possibly damaging	Het
Krt39	A	T	11: 99,521,031	C76*	probably null	Het
Lcmt1	G	T	7: 123,401,495	R84L	probably benign	Het
Lrit1	A	G	14: 37,061,780	Y355C	probably benign	Het
Mad2l1	C	A	6: 66,535,413		probably null	Het
Med23	C	T	10: 24,902,448	T870M	probably damaging	Het
Mrpl2	A	G	17: 46,648,591		probably null	Het
Mtmr6	A	G	14: 60,300,445	D593G	probably benign	Het
Myo15b	G	A	11: 115,861,340	V683M		Het
Neb	T	A	2: 52,235,488	M506L		Het
Olfr103	T	C	17: 37,336,578	Y218C	probably benign	Het
Olfr103	A	G	17: 37,337,055	F59S	probably damaging	Het
Olfr1154	G	A	2: 87,903,193	T161I	probably benign	Het
Olfr434	T	A	6: 43,217,388	H158Q	possibly damaging	Het
Pdzd8	A	G	19: 59,327,863	F294L	probably damaging	Het
Rabgap1	G	A	2: 37,487,532	S347N	possibly damaging	Het
Rasgrf2	T	C	13: 91,896,082	T350A		Het
Rbp3	A	T	14: 33,954,158	H21L	probably benign	Het
Rp1	C	A	1: 4,142,658	V1069F	unknown	Het
Rtn4	T	A	11: 29,741,048	L1113*	probably null	Het
Ryr3	A	G	2: 112,775,695	F2407L	probably damaging	Het
Sept2	T	A	1: 93,497,444	D107E	probably damaging	Het
Sept4	A	G	11: 87,579,008	T7A	probably benign	Het
Slc34a3	T	A	2: 25,232,225	I123F	probably damaging	Het
Slc9a4	T	C	1: 40,600,776	Y243H	probably damaging	Het
Slco1a1	T	A	6: 141,943,388	E66V	probably damaging	Het
Spata33	A	G	8: 123,213,252	R68G	unknown	Het
Spta1	G	A	1: 174,202,451	D928N	probably damaging	Het
St8sia5	A	G	18: 77,254,550	S319G	probably benign	Het
Tmem208	A	G	8: 105,328,833	D149G	possibly damaging	Het
Trank1	A	T	9: 111,364,103	I583F	probably damaging	Het
Trio	C	T	15: 27,763,994	V2015M	probably damaging	Het
Tsc22d1	C	T	14: 76,416,701	Q207*	probably null	Het
Tshr	A	G	12: 91,505,305	D143G	probably benign	Het
Txlna	C	T	4: 129,632,157	R299H	probably damaging	Het
Ush2a	A	T	1: 188,444,592	T1318S	possibly damaging	Het
Utp14b	A	G	1: 78,664,943	K186R	probably damaging	Het
Vars2	C	T	17: 35,658,158	A884T	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp775	A	G	6: 48,619,249	Q19R	possibly damaging	Het

Other mutations in Kifc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00720:Kifc3	APN	8	95138016	missense	probably damaging	1.00
IGL01904:Kifc3	APN	8	95137957	missense	possibly damaging	0.81
IGL02019:Kifc3	APN	8	95107540	splice site	probably benign
IGL02090:Kifc3	APN	8	95102480	missense	probably damaging	1.00
IGL02355:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02362:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02620:Kifc3	APN	8	95109954	missense	probably damaging	0.98
IGL02720:Kifc3	APN	8	95108365	missense	probably benign	0.00
IGL03030:Kifc3	APN	8	95102412	missense	probably damaging	1.00
IGL03327:Kifc3	APN	8	95108432	missense	probably damaging	1.00
IGL03390:Kifc3	APN	8	95108613	missense	probably damaging	1.00
R0233:Kifc3	UTSW	8	95101472	splice site	probably null
R0281:Kifc3	UTSW	8	95103460	missense	probably damaging	1.00
R0302:Kifc3	UTSW	8	95103470	missense	possibly damaging	0.50
R0619:Kifc3	UTSW	8	95102665	missense	probably benign	0.13
R0731:Kifc3	UTSW	8	95105733	missense	probably damaging	1.00
R1017:Kifc3	UTSW	8	95105785	missense	probably damaging	0.99
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1257:Kifc3	UTSW	8	95105772	missense	probably damaging	0.98
R1472:Kifc3	UTSW	8	95137913	critical splice donor site	probably null
R1480:Kifc3	UTSW	8	95109887	missense	probably damaging	1.00
R1553:Kifc3	UTSW	8	95106542	missense	possibly damaging	0.67
R2071:Kifc3	UTSW	8	95108353	critical splice donor site	probably null
R2115:Kifc3	UTSW	8	95108713	missense	probably damaging	1.00
R3703:Kifc3	UTSW	8	95104028	splice site	probably benign
R3704:Kifc3	UTSW	8	95104028	splice site	probably benign
R3705:Kifc3	UTSW	8	95104028	splice site	probably benign
R4223:Kifc3	UTSW	8	95109982	missense	probably damaging	0.96
R4463:Kifc3	UTSW	8	95102116	missense	probably damaging	1.00
R4508:Kifc3	UTSW	8	95107420	splice site	probably null
R4980:Kifc3	UTSW	8	95126549	missense	probably benign
R5032:Kifc3	UTSW	8	95102726	missense	probably damaging	1.00
R5068:Kifc3	UTSW	8	95110216	missense	possibly damaging	0.54
R5421:Kifc3	UTSW	8	95109845	missense	probably damaging	0.99
R5556:Kifc3	UTSW	8	95108459	nonsense	probably null
R6845:Kifc3	UTSW	8	95108679	missense	probably benign	0.28
R7136:Kifc3	UTSW	8	95103449	missense	probably benign	0.10
R7196:Kifc3	UTSW	8	95106611	missense	probably benign	0.02
R7404:Kifc3	UTSW	8	95103464	missense	probably benign	0.02
R7441:Kifc3	UTSW	8	95137987	missense	probably benign	0.00
R7861:Kifc3	UTSW	8	95107537	critical splice acceptor site	probably null
R8440:Kifc3	UTSW	8	95109794	missense	possibly damaging	0.89
R8754:Kifc3	UTSW	8	95102396	missense	probably damaging	1.00
R8983:Kifc3	UTSW	8	95106476	missense	probably damaging	1.00
R9035:Kifc3	UTSW	8	95126567	missense	possibly damaging	0.52
R9149:Kifc3	UTSW	8	95126689	missense	probably benign
X0023:Kifc3	UTSW	8	95109298	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACGTCAGCAAATGAGATCCAGC -3'
(R):5'- AGACCAGGCTAGCTTACCAG -3'

Sequencing Primer
(F):5'- ATGAGATCCAGCCCCCTG -3'
(R):5'- AGGCTAGCTTACCAGAGTTCCTG -3'

Posted On

2019-11-26