Incidental Mutation 'R7784:Tmem208'
ID 599444
Institutional Source Beutler Lab
Gene Symbol Tmem208
Ensembl Gene ENSMUSG00000014856
Gene Name transmembrane protein 208
Synonyms 2610030K20Rik, 1700006C06Rik, Hspc171
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105326354-105335219 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105328833 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 149 (D149G)
Ref Sequence ENSEMBL: ENSMUSP00000015000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000015000] [ENSMUST00000070508] [ENSMUST00000098453] [ENSMUST00000109372] [ENSMUST00000126705] [ENSMUST00000153146] [ENSMUST00000209964] [ENSMUST00000210412] [ENSMUST00000210801] [ENSMUST00000211199]
AlphaFold Q9CR96
Predicted Effect probably benign
Transcript: ENSMUST00000014922
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000015000
AA Change: D149G

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000015000
Gene: ENSMUSG00000014856
AA Change: D149G

DomainStartEndE-ValueType
Pfam:DUF788 7 171 1.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070508
SMART Domains Protein: ENSMUSP00000063248
Gene: ENSMUSG00000041679

DomainStartEndE-ValueType
LRR 42 67 7.15e-2 SMART
LRR 68 93 1.92e-2 SMART
LRR 94 119 1.23e0 SMART
LRR 120 145 1.56e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098453
SMART Domains Protein: ENSMUSP00000096052
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 3.7e-29 PFAM
low complexity region 118 133 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109372
SMART Domains Protein: ENSMUSP00000104997
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 4.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126705
SMART Domains Protein: ENSMUSP00000138226
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 100 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153146
SMART Domains Protein: ENSMUSP00000138470
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 100 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209964
Predicted Effect probably benign
Transcript: ENSMUST00000210412
Predicted Effect probably benign
Transcript: ENSMUST00000210801
Predicted Effect probably benign
Transcript: ENSMUST00000211199
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein which is localized in the endoplasmic reticulum (ER). The protein is linked to autophagy and ER stress. Knockdown of this gene increased autophagy and triggered ER stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Tmem208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:Tmem208 APN 8 105328697 splice site probably null
Agog UTSW 8 105328625 missense probably damaging 1.00
excited UTSW 8 105328431 missense probably damaging 1.00
R0066:Tmem208 UTSW 8 105328225 missense probably benign 0.38
R0164:Tmem208 UTSW 8 105334694 missense probably benign 0.01
R0164:Tmem208 UTSW 8 105334694 missense probably benign 0.01
R0566:Tmem208 UTSW 8 105334843 missense probably benign 0.00
R1569:Tmem208 UTSW 8 105334830 missense possibly damaging 0.66
R1860:Tmem208 UTSW 8 105334806 missense possibly damaging 0.66
R1861:Tmem208 UTSW 8 105334806 missense possibly damaging 0.66
R4836:Tmem208 UTSW 8 105328664 missense probably damaging 1.00
R5126:Tmem208 UTSW 8 105334650 missense probably benign 0.00
R5352:Tmem208 UTSW 8 105328431 missense probably damaging 1.00
R6862:Tmem208 UTSW 8 105328230 critical splice donor site probably null
R7289:Tmem208 UTSW 8 105334786 missense possibly damaging 0.66
R8274:Tmem208 UTSW 8 105328625 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACTGACAGCCATTGTTCAG -3'
(R):5'- CCTATAATCCAGGCTGCTTTGG -3'

Sequencing Primer
(F):5'- GACAGCCATTGTTCAGGTGCTC -3'
(R):5'- GGCTGCTTTGGCCCTTAAACTAG -3'
Posted On 2019-11-26