Incidental Mutation 'R7784:Ddx6'
ID 599446
Institutional Source Beutler Lab
Gene Symbol Ddx6
Ensembl Gene ENSMUSG00000032097
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Synonyms mRCK/P54, HLR2, rck, C430015D01Rik, 1110001P04Rik, p54, E230023J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 44604892-44640731 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 44630142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170489] [ENSMUST00000217034]
AlphaFold P54823
Predicted Effect probably null
Transcript: ENSMUST00000170489
SMART Domains Protein: ENSMUSP00000128421
Gene: ENSMUSG00000032097

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Blast:DEXDc 42 88 7e-18 BLAST
DEXDc 115 312 3.67e-52 SMART
HELICc 348 429 1.59e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217034
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The protein is an RNA helicase found in P-bodies and stress granules, and functions in translation suppression and mRNA degradation. It is required for microRNA-induced gene silencing. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Ddx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02561:Ddx6 APN 9 44634168 missense probably damaging 0.96
IGL02880:Ddx6 APN 9 44612897 splice site probably benign
R0278:Ddx6 UTSW 9 44631425 missense probably damaging 1.00
R1330:Ddx6 UTSW 9 44627773 splice site probably benign
R2001:Ddx6 UTSW 9 44607534 missense probably benign
R2002:Ddx6 UTSW 9 44607534 missense probably benign
R2124:Ddx6 UTSW 9 44624519 nonsense probably null
R2177:Ddx6 UTSW 9 44627731 missense probably damaging 1.00
R2347:Ddx6 UTSW 9 44607591 missense probably benign 0.00
R2863:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R2865:Ddx6 UTSW 9 44614256 missense probably damaging 1.00
R4584:Ddx6 UTSW 9 44624487 missense probably damaging 1.00
R4915:Ddx6 UTSW 9 44612873 missense probably damaging 1.00
R5476:Ddx6 UTSW 9 44607456 missense possibly damaging 0.67
R6213:Ddx6 UTSW 9 44628693 missense probably damaging 0.99
R6264:Ddx6 UTSW 9 44628752 missense probably damaging 1.00
R6368:Ddx6 UTSW 9 44635776 missense probably damaging 1.00
R6525:Ddx6 UTSW 9 44623629 missense probably damaging 1.00
R6994:Ddx6 UTSW 9 44628723 missense probably damaging 0.98
R7252:Ddx6 UTSW 9 44623753 splice site probably null
R7463:Ddx6 UTSW 9 44628729 missense probably damaging 1.00
R7706:Ddx6 UTSW 9 44627642 missense probably damaging 1.00
R7752:Ddx6 UTSW 9 44627663 missense probably damaging 1.00
RF004:Ddx6 UTSW 9 44624492 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGGTGGCCCTTATGAGATAATC -3'
(R):5'- GGTCTCTTTGTCTACTAAATAGTCCG -3'

Sequencing Primer
(F):5'- GGTGGCCCTTATGAGATAATCTTCTC -3'
(R):5'- TGTCTACTAAATAGTCCGTTCATTTG -3'
Posted On 2019-11-26