Incidental Mutation 'R7784:Fbxw25'
ID 599447
Institutional Source Beutler Lab
Gene Symbol Fbxw25
Ensembl Gene ENSMUSG00000094992
Gene Name F-box and WD-40 domain protein 25
Synonyms E330001B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 109645122-109664652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 109650119 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 355 (D355N)
Ref Sequence ENSEMBL: ENSMUSP00000128652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163839]
AlphaFold F7C9P2
Predicted Effect
SMART Domains Protein: ENSMUSP00000128652
Gene: ENSMUSG00000094992
AA Change: D355N

DomainStartEndE-ValueType
FBOX 5 45 5.44e-6 SMART
SCOP:d1gxra_ 119 228 1e-6 SMART
Blast:WD40 137 176 6e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Fbxw25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03330:Fbxw25 APN 9 109645239 missense probably benign 0.00
goodtimes UTSW 9 109663374 critical splice donor site probably null
shakeys UTSW 9 109654583 missense
R0158:Fbxw25 UTSW 9 109654652 missense possibly damaging 0.74
R0850:Fbxw25 UTSW 9 109649617 missense probably benign
R1109:Fbxw25 UTSW 9 109650060 missense probably benign 0.00
R1386:Fbxw25 UTSW 9 109654641 missense possibly damaging 0.77
R1609:Fbxw25 UTSW 9 109663510 missense probably benign 0.11
R1750:Fbxw25 UTSW 9 109650073 missense probably benign 0.23
R1977:Fbxw25 UTSW 9 109652856 missense possibly damaging 0.72
R2427:Fbxw25 UTSW 9 109652860 missense probably benign 0.09
R3841:Fbxw25 UTSW 9 109662134 nonsense probably null
R4356:Fbxw25 UTSW 9 109662085 missense probably damaging 1.00
R4934:Fbxw25 UTSW 9 109651637 missense possibly damaging 0.63
R5024:Fbxw25 UTSW 9 109663374 critical splice donor site probably null
R5175:Fbxw25 UTSW 9 109664563 missense probably damaging 1.00
R5323:Fbxw25 UTSW 9 109663505 missense probably benign 0.04
R5389:Fbxw25 UTSW 9 109652886 missense possibly damaging 0.95
R5493:Fbxw25 UTSW 9 109652916 missense probably benign 0.01
R6268:Fbxw25 UTSW 9 109654650 missense probably damaging 1.00
R6739:Fbxw25 UTSW 9 109651631 missense probably benign 0.29
R7275:Fbxw25 UTSW 9 109654592 missense
R7492:Fbxw25 UTSW 9 109664530 critical splice donor site probably null
R7623:Fbxw25 UTSW 9 109654583 missense
R7861:Fbxw25 UTSW 9 109664557 nonsense probably null
R7887:Fbxw25 UTSW 9 109649594 critical splice donor site probably null
R8973:Fbxw25 UTSW 9 109650064 missense
X0023:Fbxw25 UTSW 9 109651775 missense possibly damaging 0.94
Z1176:Fbxw25 UTSW 9 109651738 missense
Predicted Primers PCR Primer
(F):5'- TAGGCTGGAGTCAATGTCAGAC -3'
(R):5'- CTAGCATGCCATGGAAGGAG -3'

Sequencing Primer
(F):5'- AGTCTGCCTGTGAACTCTGCAAG -3'
(R):5'- CCATGGAAGGAGGGATATGCTTTTC -3'
Posted On 2019-11-26