Incidental Mutation 'R7784:Col10a1'
ID 599450
Institutional Source Beutler Lab
Gene Symbol Col10a1
Ensembl Gene ENSMUSG00000039462
Gene Name collagen, type X, alpha 1
Synonyms Col10a-1, Col10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 34389981-34397085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34394218 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 62 (P62H)
Ref Sequence ENSEMBL: ENSMUSP00000101150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000099973] [ENSMUST00000105511] [ENSMUST00000105512] [ENSMUST00000213269]
AlphaFold Q05306
Predicted Effect probably benign
Transcript: ENSMUST00000047885
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099973
SMART Domains Protein: ENSMUSP00000097553
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 189 8.8e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000105511
AA Change: P62H
SMART Domains Protein: ENSMUSP00000101150
Gene: ENSMUSG00000039462
AA Change: P62H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 60 101 N/A INTRINSIC
Pfam:Collagen 103 155 1.4e-9 PFAM
Pfam:Collagen 153 218 1.4e-8 PFAM
Pfam:Collagen 193 250 2.6e-9 PFAM
Pfam:Collagen 206 264 3.8e-8 PFAM
low complexity region 282 323 N/A INTRINSIC
internal_repeat_2 329 361 2.25e-6 PROSPERO
internal_repeat_1 331 365 5.9e-14 PROSPERO
low complexity region 368 383 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
Pfam:Collagen 413 483 9.3e-10 PFAM
low complexity region 487 517 N/A INTRINSIC
C1Q 545 680 2.85e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105512
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213269
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type X collagen, a short chain collagen expressed by hypertrophic chondrocytes during endochondral ossification. Unlike type VIII collagen, the other short chain collagen, type X collagen is a homotrimer. Mutations in this gene are associated with Schmid type metaphyseal chondrodysplasia (SMCD) and Japanese type spondylometaphyseal dysplasia (SMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations may exhibit abnormal trabecular bone, thinner growth plate resting zone and articular cartilage, and altered bone content. Mice homozygous for another knock-out allele exhibit altered B and T cell populations and TH1/TH2responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Col10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03005:Col10a1 APN 10 34395738 missense probably damaging 1.00
IGL03028:Col10a1 APN 10 34395016 missense probably benign 0.19
R0580:Col10a1 UTSW 10 34394952 missense probably benign 0.31
R0691:Col10a1 UTSW 10 34395696 missense possibly damaging 0.94
R1187:Col10a1 UTSW 10 34394838 missense probably benign 0.13
R1597:Col10a1 UTSW 10 34395078 missense probably damaging 0.99
R1724:Col10a1 UTSW 10 34395718 missense probably damaging 1.00
R1826:Col10a1 UTSW 10 34394649 missense probably damaging 1.00
R1834:Col10a1 UTSW 10 34395015 missense probably damaging 1.00
R2156:Col10a1 UTSW 10 34395700 missense probably benign 0.30
R3687:Col10a1 UTSW 10 34395498 missense probably benign 0.12
R4208:Col10a1 UTSW 10 34395543 missense probably damaging 0.99
R4929:Col10a1 UTSW 10 34395124 missense probably benign 0.00
R5411:Col10a1 UTSW 10 34394557 missense probably damaging 1.00
R5433:Col10a1 UTSW 10 34390739 intron probably benign
R5481:Col10a1 UTSW 10 34395664 missense probably benign 0.09
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6208:Col10a1 UTSW 10 34394586 missense possibly damaging 0.69
R6223:Col10a1 UTSW 10 34395187 missense probably damaging 1.00
R7019:Col10a1 UTSW 10 34394951 missense probably damaging 0.96
R7642:Col10a1 UTSW 10 34395642 missense probably benign 0.00
R8072:Col10a1 UTSW 10 34390667 missense unknown
R8711:Col10a1 UTSW 10 34394828 missense probably damaging 1.00
Z1176:Col10a1 UTSW 10 34395178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGACAAATACACTCCCC -3'
(R):5'- GCTGGGCCAATATCTCCTTTG -3'

Sequencing Primer
(F):5'- TGGACAAATACACTCCCCAGAGC -3'
(R):5'- CAATATCTCCTTTGTGTCCATATGG -3'
Posted On 2019-11-26