Incidental Mutation 'R7784:Ddc'
ID599451
Institutional Source Beutler Lab
Gene Symbol Ddc
Ensembl Gene ENSMUSG00000020182
Gene Namedopa decarboxylase
SynonymsAadc, aromatic L-amino acid decarboxylase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7784 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location11814101-11898144 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 11839396 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066237] [ENSMUST00000066237] [ENSMUST00000066237] [ENSMUST00000109659] [ENSMUST00000109659] [ENSMUST00000109659] [ENSMUST00000178704] [ENSMUST00000178704] [ENSMUST00000178704]
Predicted Effect probably null
Transcript: ENSMUST00000066237
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066237
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066237
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109659
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109659
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109659
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178704
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178704
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178704
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit preweaning phenotype. Mice homozygous for a different knock-in allele exhibit partial prenatal lethality, decreased body size, postnatal growth retardation, hypoactivity, increased anxiety, tremors, decreased heart rate and decreased dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Ddc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Ddc APN 11 11839462 missense probably damaging 1.00
IGL01336:Ddc APN 11 11846630 splice site probably null
IGL02257:Ddc APN 11 11873171 nonsense probably null
IGL02327:Ddc APN 11 11863739 missense probably damaging 0.98
IGL02516:Ddc APN 11 11829125 missense probably damaging 1.00
IGL02616:Ddc APN 11 11880645 utr 5 prime probably benign
IGL02888:Ddc APN 11 11822297 splice site probably benign
IGL03267:Ddc APN 11 11876303 missense probably damaging 1.00
R0454:Ddc UTSW 11 11880587 missense possibly damaging 0.88
R1061:Ddc UTSW 11 11829132 missense probably benign 0.00
R1173:Ddc UTSW 11 11846634 critical splice donor site probably null
R1382:Ddc UTSW 11 11824856 missense possibly damaging 0.52
R1549:Ddc UTSW 11 11846656 unclassified probably null
R1583:Ddc UTSW 11 11829131 missense probably benign 0.17
R1929:Ddc UTSW 11 11835764 missense probably damaging 1.00
R1970:Ddc UTSW 11 11815292 missense possibly damaging 0.87
R2034:Ddc UTSW 11 11880456 missense probably benign 0.40
R2270:Ddc UTSW 11 11835764 missense probably damaging 1.00
R2272:Ddc UTSW 11 11835764 missense probably damaging 1.00
R4449:Ddc UTSW 11 11835802 missense probably damaging 1.00
R4508:Ddc UTSW 11 11819393 critical splice acceptor site probably null
R4799:Ddc UTSW 11 11846632 splice site probably null
R5307:Ddc UTSW 11 11876321 missense probably damaging 1.00
R6654:Ddc UTSW 11 11880452 missense probably damaging 1.00
R6817:Ddc UTSW 11 11824854 missense probably damaging 1.00
R6918:Ddc UTSW 11 11819307 missense probably damaging 1.00
R7001:Ddc UTSW 11 11824870 critical splice acceptor site probably null
Z1177:Ddc UTSW 11 11880552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAAGTTCCTGGCTCCCCG -3'
(R):5'- AGTGGTATGTATGCTAGACGC -3'

Sequencing Primer
(F):5'- CAACTGGCTAGAAAGTAGTTTGCTG -3'
(R):5'- TGCTAGACGCACAAGGTTG -3'
Posted On2019-11-26