Incidental Mutation 'R7784:Rtn4'
ID 599452
Institutional Source Beutler Lab
Gene Symbol Rtn4
Ensembl Gene ENSMUSG00000020458
Gene Name reticulon 4
Synonyms NOGO, C130026I10Rik, NgA, 1110020G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 29692947-29744331 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 29741048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 1113 (L1113*)
Ref Sequence ENSEMBL: ENSMUSP00000099907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000060992] [ENSMUST00000078830] [ENSMUST00000102841] [ENSMUST00000102842] [ENSMUST00000102843] [ENSMUST00000170731]
AlphaFold Q99P72
Predicted Effect probably benign
Transcript: ENSMUST00000058902
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060992
AA Change: L150*
SMART Domains Protein: ENSMUSP00000053754
Gene: ENSMUSG00000020458
AA Change: L150*

DomainStartEndE-ValueType
Pfam:Reticulon 12 182 7.4e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078830
AA Change: L307*
SMART Domains Protein: ENSMUSP00000077875
Gene: ENSMUSG00000020458
AA Change: L307*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102841
AA Change: L997*
SMART Domains Protein: ENSMUSP00000099905
Gene: ENSMUSG00000020458
AA Change: L997*

DomainStartEndE-ValueType
low complexity region 102 110 N/A INTRINSIC
Pfam:Reticulon 859 1029 6.3e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102842
AA Change: L326*
SMART Domains Protein: ENSMUSP00000099906
Gene: ENSMUSG00000020458
AA Change: L326*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 188 358 4.8e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102843
AA Change: L1113*
SMART Domains Protein: ENSMUSP00000099907
Gene: ENSMUSG00000020458
AA Change: L1113*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
low complexity region 218 226 N/A INTRINSIC
Pfam:Reticulon 975 1139 2.4e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170731
AA Change: L307*
SMART Domains Protein: ENSMUSP00000126413
Gene: ENSMUSG00000020458
AA Change: L307*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the A and B isoforms are viable and one line shows enhanced regeneration and recovery after spinal cord injury. Different lines of mice lacking isoforms A, B, and C show varying phenotypes. Whereas some produce viable homozygotes, others are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Rtn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Rtn4 APN 11 29707291 missense probably damaging 1.00
IGL02187:Rtn4 APN 11 29708291 missense possibly damaging 0.78
IGL02475:Rtn4 APN 11 29733801 missense probably damaging 1.00
IGL02751:Rtn4 APN 11 29706409 critical splice acceptor site probably null
R0063:Rtn4 UTSW 11 29705527 intron probably benign
R0110:Rtn4 UTSW 11 29733849 splice site probably benign
R0510:Rtn4 UTSW 11 29733849 splice site probably benign
R0653:Rtn4 UTSW 11 29707256 missense probably damaging 1.00
R0658:Rtn4 UTSW 11 29706475 missense probably damaging 1.00
R1353:Rtn4 UTSW 11 29707595 missense probably damaging 1.00
R1384:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1873:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1960:Rtn4 UTSW 11 29736464 missense probably damaging 1.00
R1980:Rtn4 UTSW 11 29708634 missense probably benign 0.00
R2319:Rtn4 UTSW 11 29707154 missense probably benign 0.06
R2888:Rtn4 UTSW 11 29693687 missense probably damaging 0.98
R3150:Rtn4 UTSW 11 29693308 small deletion probably benign
R3403:Rtn4 UTSW 11 29707690 missense probably benign 0.12
R3974:Rtn4 UTSW 11 29707505 missense probably damaging 1.00
R3977:Rtn4 UTSW 11 29693819 missense probably benign 0.01
R4223:Rtn4 UTSW 11 29706856 missense probably benign 0.02
R4725:Rtn4 UTSW 11 29708362 missense probably damaging 1.00
R4801:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4802:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4974:Rtn4 UTSW 11 29740994 missense probably damaging 1.00
R4983:Rtn4 UTSW 11 29707217 missense probably benign 0.43
R5292:Rtn4 UTSW 11 29707924 missense probably benign 0.39
R5332:Rtn4 UTSW 11 29733645 missense probably damaging 1.00
R5551:Rtn4 UTSW 11 29741011 missense probably damaging 1.00
R5604:Rtn4 UTSW 11 29708140 missense probably damaging 0.97
R6046:Rtn4 UTSW 11 29708023 missense probably damaging 1.00
R6928:Rtn4 UTSW 11 29706791 missense possibly damaging 0.92
R7386:Rtn4 UTSW 11 29707772 missense probably damaging 1.00
R7743:Rtn4 UTSW 11 29733790 nonsense probably null
R7832:Rtn4 UTSW 11 29741048 nonsense probably null
R7846:Rtn4 UTSW 11 29693274 missense unknown
R7896:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
R8297:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
R8420:Rtn4 UTSW 11 29707300 missense probably damaging 0.99
R8724:Rtn4 UTSW 11 29693316 missense unknown
R8823:Rtn4 UTSW 11 29706609 missense probably benign 0.05
R8872:Rtn4 UTSW 11 29708633 missense probably benign 0.17
R9196:Rtn4 UTSW 11 29708471 missense probably benign 0.00
R9223:Rtn4 UTSW 11 29706778 missense probably benign 0.00
R9384:Rtn4 UTSW 11 29708471 missense probably benign 0.00
RF006:Rtn4 UTSW 11 29706919 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGCAGTTCTGCTCTATCATGG -3'
(R):5'- GCACCTAAGGCAGCTGTTAG -3'

Sequencing Primer
(F):5'- AGTGAATCAACTCCCATTTTTGGTC -3'
(R):5'- GCTGTTAGCTGGAGTAGTCTTC -3'
Posted On 2019-11-26