Incidental Mutation 'R7784:Zfp354c'
ID599453
Institutional Source Beutler Lab
Gene Symbol Zfp354c
Ensembl Gene ENSMUSG00000044807
Gene Namezinc finger protein 354C
SynonymsAJ18, Kid3, 5330421P20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R7784 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location50811086-50827724 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) TCACACTCGGCACA to TCACA at 50815240 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000632] [ENSMUST00000109135]
Predicted Effect probably benign
Transcript: ENSMUST00000000632
SMART Domains Protein: ENSMUSP00000000632
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109135
SMART Domains Protein: ENSMUSP00000104763
Gene: ENSMUSG00000044807

DomainStartEndE-ValueType
KRAB 14 74 9.98e-33 SMART
ZnF_C2H2 218 240 5.9e-3 SMART
ZnF_C2H2 246 268 3.74e-5 SMART
ZnF_C2H2 274 296 1.72e-4 SMART
ZnF_C2H2 302 324 7.78e-3 SMART
ZnF_C2H2 330 352 1.92e-2 SMART
ZnF_C2H2 358 380 4.79e-3 SMART
ZnF_C2H2 386 408 1.1e-2 SMART
ZnF_C2H2 414 436 5.67e-5 SMART
ZnF_C2H2 442 464 9.08e-4 SMART
ZnF_C2H2 470 492 5.59e-4 SMART
ZnF_C2H2 498 520 3.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Zfp354c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Zfp354c APN 11 50815613 missense probably damaging 0.97
IGL01615:Zfp354c APN 11 50817905 missense possibly damaging 0.90
IGL03019:Zfp354c APN 11 50817194 missense probably damaging 1.00
R0546:Zfp354c UTSW 11 50815630 missense probably benign 0.12
R1370:Zfp354c UTSW 11 50815840 missense probably benign
R2109:Zfp354c UTSW 11 50817142 missense probably benign 0.01
R2850:Zfp354c UTSW 11 50815331 nonsense probably null
R4010:Zfp354c UTSW 11 50814944 missense probably damaging 0.98
R5034:Zfp354c UTSW 11 50815039 missense probably benign 0.14
R5430:Zfp354c UTSW 11 50815195 missense probably benign 0.02
R5439:Zfp354c UTSW 11 50815770 missense probably benign 0.01
R5905:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R6244:Zfp354c UTSW 11 50814971 missense probably benign 0.41
R6264:Zfp354c UTSW 11 50815447 missense probably benign 0.00
R6591:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R6650:Zfp354c UTSW 11 50814691 missense probably damaging 1.00
R6691:Zfp354c UTSW 11 50814775 missense probably benign 0.41
R7087:Zfp354c UTSW 11 50815213 missense probably damaging 1.00
R7313:Zfp354c UTSW 11 50814656 missense probably damaging 1.00
R7467:Zfp354c UTSW 11 50815426 missense probably damaging 1.00
R7619:Zfp354c UTSW 11 50817808 critical splice donor site probably null
R7710:Zfp354c UTSW 11 50815240 small deletion probably benign
R7712:Zfp354c UTSW 11 50815240 small deletion probably benign
R7747:Zfp354c UTSW 11 50815240 small deletion probably benign
R7748:Zfp354c UTSW 11 50815240 small deletion probably benign
R7816:Zfp354c UTSW 11 50815240 small deletion probably benign
R7817:Zfp354c UTSW 11 50815240 small deletion probably benign
R7853:Zfp354c UTSW 11 50815240 small deletion probably benign
R7855:Zfp354c UTSW 11 50815240 small deletion probably benign
R7870:Zfp354c UTSW 11 50815238 small deletion probably benign
R7936:Zfp354c UTSW 11 50815240 small deletion probably benign
R7938:Zfp354c UTSW 11 50815240 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTAAAGGTTCTCCCACATTGC -3'
(R):5'- CCTGCTACGTATCACACTTCAG -3'

Sequencing Primer
(F):5'- TTGCAAACACTGGCAAAGCTG -3'
(R):5'- TCTTCTAGAGCACAAGAGGCTTC -3'
Posted On2019-11-26