Incidental Mutation 'R7784:Krt39'
ID 599455
Institutional Source Beutler Lab
Gene Symbol Krt39
Ensembl Gene ENSMUSG00000064165
Gene Name keratin 39
Synonyms 4732494G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 99514114-99521338 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 99521031 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 76 (C76*)
Ref Sequence ENSEMBL: ENSMUSP00000076216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076948] [ENSMUST00000107445]
AlphaFold Q6IFX4
Predicted Effect probably null
Transcript: ENSMUST00000076948
AA Change: C76*
SMART Domains Protein: ENSMUSP00000076216
Gene: ENSMUSG00000064165
AA Change: C76*

DomainStartEndE-ValueType
Pfam:Filament 90 401 7.9e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107445
AA Change: C76*
SMART Domains Protein: ENSMUSP00000103069
Gene: ENSMUSG00000064165
AA Change: C76*

DomainStartEndE-ValueType
Filament 90 401 2.63e-130 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Krt39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Krt39 APN 11 99519063 missense probably damaging 0.97
IGL02179:Krt39 APN 11 99520841 missense probably damaging 1.00
IGL02478:Krt39 APN 11 99520897 missense probably benign 0.37
IGL02578:Krt39 APN 11 99521206 missense probably benign 0.00
IGL03090:Krt39 APN 11 99519007 splice site probably benign
IGL03094:Krt39 APN 11 99520802 splice site probably benign
R0532:Krt39 UTSW 11 99514791 missense possibly damaging 0.92
R0789:Krt39 UTSW 11 99521062 missense probably benign 0.00
R1856:Krt39 UTSW 11 99519088 nonsense probably null
R1920:Krt39 UTSW 11 99514635 missense probably benign 0.00
R1944:Krt39 UTSW 11 99519823 missense probably damaging 1.00
R4391:Krt39 UTSW 11 99514752 missense probably benign 0.01
R4678:Krt39 UTSW 11 99521000 missense probably benign 0.02
R4921:Krt39 UTSW 11 99514749 missense possibly damaging 0.80
R5800:Krt39 UTSW 11 99521145 missense probably benign 0.09
R6207:Krt39 UTSW 11 99521215 missense probably damaging 1.00
R6904:Krt39 UTSW 11 99519821 missense probably damaging 1.00
R7034:Krt39 UTSW 11 99521236 missense probably benign 0.19
R7036:Krt39 UTSW 11 99521236 missense probably benign 0.19
R7131:Krt39 UTSW 11 99520871 missense probably benign
R7424:Krt39 UTSW 11 99518091 missense probably damaging 1.00
R7449:Krt39 UTSW 11 99518061 missense probably benign 0.02
R7627:Krt39 UTSW 11 99514749 missense possibly damaging 0.80
R7774:Krt39 UTSW 11 99514611 splice site probably null
R7827:Krt39 UTSW 11 99519075 missense probably damaging 1.00
R8896:Krt39 UTSW 11 99518269 missense probably damaging 0.99
R8961:Krt39 UTSW 11 99519105 missense possibly damaging 0.52
R9245:Krt39 UTSW 11 99516624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTCTTACCTTCTGCTGCAG -3'
(R):5'- ACCATGGATACCAAGGGCTC -3'

Sequencing Primer
(F):5'- TGCTGCAGCTCCTCGATG -3'
(R):5'- CAAGGGCTCTACAGTGACGATTTC -3'
Posted On 2019-11-26