Mutagenetix > Incidental Mutations

Incidental Mutation 'R7784:Tshr'

599458

Institutional Source

Beutler Lab

Gene Symbol

Tshr

Ensembl Gene

ENSMUSG00000020963

Gene Name

thyroid stimulating hormone receptor

Synonyms

pet, hyt, hypothroid

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.221) question?

Stock #

R7784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91384563-91549808 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91505305 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 143 (D143G)

Ref Sequence

ENSEMBL: ENSMUSP00000021346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021343] [ENSMUST00000021346] [ENSMUST00000221216]

AlphaFold

P47750

Predicted Effect

probably benign
Transcript: ENSMUST00000021343
AA Change: D143G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000021343
Gene: ENSMUSG00000020963
AA Change: D143G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:LRR_5	53	143	1e-6	PFAM
Pfam:LRR_5	137	228	3.8e-5	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000021346
AA Change: D143G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: D143G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:LRR_5	53	153	9.5e-7	PFAM
Pfam:LRR_5	148	244	5.1e-5	PFAM
Pfam:7tm_1	431	678	2.6e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221216
AA Change: D41G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

Meta Mutation Damage Score

0.6573

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	A	T	5: 146,182,828		probably null	Het
3425401B19Rik	A	T	14: 32,659,840	S1389R	probably benign	Het
Abca9	A	T	11: 110,154,417	C363*	probably null	Het
Actbl2	T	A	13: 111,255,411	N93K	probably damaging	Het
Adamtsl3	T	C	7: 82,573,989	Y993H	probably damaging	Het
Adgrg1	G	A	8: 95,012,882	W653*	probably null	Het
Akap13	T	A	7: 75,610,328	V97D	probably benign	Het
C130026I21Rik	T	A	1: 85,212,474		probably null	Het
Cacna1d	T	A	14: 30,123,439	D613V	probably damaging	Het
Col10a1	C	A	10: 34,394,218	P62H	unknown	Het
Cpb2	A	T	14: 75,275,040	N298Y	probably damaging	Het
Ddc	A	G	11: 11,839,396		probably null	Het
Ddx6	T	C	9: 44,630,142		probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Eps8	T	A	6: 137,499,587	I605L	probably benign	Het
Eps8l1	T	C	7: 4,472,122	L304P	probably damaging	Het
Erbb4	T	A	1: 68,075,499	I929F	probably damaging	Het
Erc2	A	T	14: 27,898,594	N393I	probably damaging	Het
Fbxw25	C	T	9: 109,650,119	D355N		Het
Ffar2	T	C	7: 30,819,258	K286E	probably benign	Het
Gabrd	A	G	4: 155,388,932		probably null	Het
Ganc	G	A	2: 120,436,668	W488*	probably null	Het
Gm5724	C	T	6: 141,713,193		probably null	Het
Ifi207	T	A	1: 173,730,132	M347L	unknown	Het
Kat6b	A	T	14: 21,660,841	I619F	probably damaging	Het
Kif26a	A	G	12: 112,178,147	R1612G	possibly damaging	Het
Kifc3	A	G	8: 95,110,692		probably null	Het
Krt39	A	T	11: 99,521,031	C76*	probably null	Het
Lcmt1	G	T	7: 123,401,495	R84L	probably benign	Het
Lrit1	A	G	14: 37,061,780	Y355C	probably benign	Het
Mad2l1	C	A	6: 66,535,413		probably null	Het
Med23	C	T	10: 24,902,448	T870M	probably damaging	Het
Mrpl2	A	G	17: 46,648,591		probably null	Het
Mtmr6	A	G	14: 60,300,445	D593G	probably benign	Het
Myo15b	G	A	11: 115,861,340	V683M		Het
Neb	T	A	2: 52,235,488	M506L		Het
Olfr103	T	C	17: 37,336,578	Y218C	probably benign	Het
Olfr103	A	G	17: 37,337,055	F59S	probably damaging	Het
Olfr1154	G	A	2: 87,903,193	T161I	probably benign	Het
Olfr434	T	A	6: 43,217,388	H158Q	possibly damaging	Het
Pdzd8	A	G	19: 59,327,863	F294L	probably damaging	Het
Rabgap1	G	A	2: 37,487,532	S347N	possibly damaging	Het
Rasgrf2	T	C	13: 91,896,082	T350A		Het
Rbp3	A	T	14: 33,954,158	H21L	probably benign	Het
Rp1	C	A	1: 4,142,658	V1069F	unknown	Het
Rtn4	T	A	11: 29,741,048	L1113*	probably null	Het
Ryr3	A	G	2: 112,775,695	F2407L	probably damaging	Het
Sept2	T	A	1: 93,497,444	D107E	probably damaging	Het
Sept4	A	G	11: 87,579,008	T7A	probably benign	Het
Slc34a3	T	A	2: 25,232,225	I123F	probably damaging	Het
Slc9a4	T	C	1: 40,600,776	Y243H	probably damaging	Het
Slco1a1	T	A	6: 141,943,388	E66V	probably damaging	Het
Spata33	A	G	8: 123,213,252	R68G	unknown	Het
Spta1	G	A	1: 174,202,451	D928N	probably damaging	Het
St8sia5	A	G	18: 77,254,550	S319G	probably benign	Het
Tmem208	A	G	8: 105,328,833	D149G	possibly damaging	Het
Trank1	A	T	9: 111,364,103	I583F	probably damaging	Het
Trio	C	T	15: 27,763,994	V2015M	probably damaging	Het
Tsc22d1	C	T	14: 76,416,701	Q207*	probably null	Het
Txlna	C	T	4: 129,632,157	R299H	probably damaging	Het
Ush2a	A	T	1: 188,444,592	T1318S	possibly damaging	Het
Utp14b	A	G	1: 78,664,943	K186R	probably damaging	Het
Vars2	C	T	17: 35,658,158	A884T	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp775	A	G	6: 48,619,249	Q19R	possibly damaging	Het

Other mutations in Tshr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00647:Tshr	APN	12	91537500	missense	probably damaging	1.00
IGL01503:Tshr	APN	12	91511934	missense	probably damaging	1.00
IGL01730:Tshr	APN	12	91519303	missense	possibly damaging	0.93
IGL02109:Tshr	APN	12	91537992	missense	probably damaging	1.00
IGL02199:Tshr	APN	12	91538283	missense	probably damaging	1.00
IGL02439:Tshr	APN	12	91537547	missense	probably damaging	0.97
IGL02696:Tshr	APN	12	91493329	missense	possibly damaging	0.72
IGL03170:Tshr	APN	12	91537869	missense	probably damaging	1.00
IGL03208:Tshr	APN	12	91533942	missense	probably damaging	1.00
freckle	UTSW	12	91538226	nonsense	probably null
R0067_Tshr_655	UTSW	12	91505283	missense	probably damaging	1.00
R0017:Tshr	UTSW	12	91537886	missense	possibly damaging	0.95
R0017:Tshr	UTSW	12	91537886	missense	possibly damaging	0.95
R0067:Tshr	UTSW	12	91505283	missense	probably damaging	1.00
R0419:Tshr	UTSW	12	91537869	missense	probably damaging	1.00
R0658:Tshr	UTSW	12	91538226	nonsense	probably null
R0724:Tshr	UTSW	12	91538286	missense	probably damaging	1.00
R1170:Tshr	UTSW	12	91538097	missense	probably damaging	1.00
R1188:Tshr	UTSW	12	91502168	missense	probably benign	0.00
R1548:Tshr	UTSW	12	91534031	missense	probably damaging	1.00
R1677:Tshr	UTSW	12	91537341	missense	possibly damaging	0.81
R1808:Tshr	UTSW	12	91537316	missense	probably benign	0.00
R1934:Tshr	UTSW	12	91537181	missense	probably damaging	0.99
R3980:Tshr	UTSW	12	91537743	missense	probably damaging	1.00
R4008:Tshr	UTSW	12	91537494	missense	probably benign	0.21
R4828:Tshr	UTSW	12	91537790	missense	probably damaging	1.00
R4903:Tshr	UTSW	12	91401188	missense	probably benign	0.09
R4958:Tshr	UTSW	12	91538187	missense	probably damaging	1.00
R5528:Tshr	UTSW	12	91537193	missense	probably damaging	1.00
R5949:Tshr	UTSW	12	91537218	missense	probably damaging	1.00
R6136:Tshr	UTSW	12	91538234	missense	probably benign	0.34
R6147:Tshr	UTSW	12	91538235	missense	possibly damaging	0.84
R6454:Tshr	UTSW	12	91538549	missense	probably benign	0.33
R6572:Tshr	UTSW	12	91538360	missense	probably benign	0.29
R6884:Tshr	UTSW	12	91538102	missense	probably damaging	1.00
R6986:Tshr	UTSW	12	91533957	missense	probably damaging	0.97
R7403:Tshr	UTSW	12	91497774	missense	probably damaging	1.00
R7691:Tshr	UTSW	12	91497741	missense	probably benign	0.00
R7741:Tshr	UTSW	12	91533969	nonsense	probably null
R7769:Tshr	UTSW	12	91538270	missense	probably damaging	1.00
R7934:Tshr	UTSW	12	91511928	missense	possibly damaging	0.88
R8060:Tshr	UTSW	12	91538360	missense	probably benign	0.12
R8168:Tshr	UTSW	12	91511965	missense	probably benign	0.19
R8552:Tshr	UTSW	12	91537285	missense	probably benign	0.00
R8762:Tshr	UTSW	12	91537550	missense	probably damaging	1.00
R8917:Tshr	UTSW	12	91502055	intron	probably benign
R8918:Tshr	UTSW	12	91537437	missense	probably benign	0.00
R8945:Tshr	UTSW	12	91538223	missense	probably damaging	1.00
R9002:Tshr	UTSW	12	91537774	missense	possibly damaging	0.95
R9056:Tshr	UTSW	12	91507789	missense	probably damaging	1.00
R9122:Tshr	UTSW	12	91511963	missense	probably benign	0.19
R9126:Tshr	UTSW	12	91537218	missense	probably damaging	1.00
R9282:Tshr	UTSW	12	91507744	missense	possibly damaging	0.53
Z1176:Tshr	UTSW	12	91538491	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GTACTGGTGTTAGCACTCGC -3'
(R):5'- ACAGGCCATCATTTCACTCATC -3'

Sequencing Primer
(F):5'- CCACAGTCATGACATTGAGTGG -3'
(R):5'- ATCCTTCAGCACAATTACCCTG -3'

Posted On

2019-11-26