Mutagenetix > Incidental Mutation

Incidental Mutation 'R7784:3425401B19Rik'

599465

Institutional Source

Beutler Lab

Gene Symbol

3425401B19Rik

Ensembl Gene

ENSMUSG00000071540

Gene Name

RIKEN cDNA 3425401B19 gene

Synonyms

MMRRC Submission

045840-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R7784 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32659119-32685293 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32659840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1389 (S1389R)

Ref Sequence

ENSEMBL: ENSMUSP00000093741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096038]

AlphaFold

D3Z1D3

Predicted Effect

probably benign
Transcript: ENSMUST00000096038
AA Change: S1389R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: S1389R

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
low complexity region	162	175	N/A	INTRINSIC
low complexity region	386	399	N/A	INTRINSIC
low complexity region	587	602	N/A	INTRINSIC
low complexity region	605	624	N/A	INTRINSIC
low complexity region	728	744	N/A	INTRINSIC
low complexity region	1002	1015	N/A	INTRINSIC
low complexity region	1086	1097	N/A	INTRINSIC
low complexity region	1147	1158	N/A	INTRINSIC
low complexity region	1161	1176	N/A	INTRINSIC
Pfam:DUF4585	1251	1322	6.5e-30	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001J03Rik	A	T	5: 146,182,828		probably null	Het
Abca9	A	T	11: 110,154,417	C363*	probably null	Het
Actbl2	T	A	13: 111,255,411	N93K	probably damaging	Het
Adamtsl3	T	C	7: 82,573,989	Y993H	probably damaging	Het
Adgrg1	G	A	8: 95,012,882	W653*	probably null	Het
Akap13	T	A	7: 75,610,328	V97D	probably benign	Het
C130026I21Rik	T	A	1: 85,212,474		probably null	Het
Cacna1d	T	A	14: 30,123,439	D613V	probably damaging	Het
Col10a1	C	A	10: 34,394,218	P62H	unknown	Het
Cpb2	A	T	14: 75,275,040	N298Y	probably damaging	Het
Ddc	A	G	11: 11,839,396		probably null	Het
Ddx6	T	C	9: 44,630,142		probably null	Het
Epb42	T	G	2: 121,034,435	K58N	probably benign	Het
Eps8	T	A	6: 137,499,587	I605L	probably benign	Het
Eps8l1	T	C	7: 4,472,122	L304P	probably damaging	Het
Erbb4	T	A	1: 68,075,499	I929F	probably damaging	Het
Erc2	A	T	14: 27,898,594	N393I	probably damaging	Het
Fbxw25	C	T	9: 109,650,119	D355N		Het
Ffar2	T	C	7: 30,819,258	K286E	probably benign	Het
Gabrd	A	G	4: 155,388,932		probably null	Het
Ganc	G	A	2: 120,436,668	W488*	probably null	Het
Gm5724	C	T	6: 141,713,193		probably null	Het
Ifi207	T	A	1: 173,730,132	M347L	unknown	Het
Kat6b	A	T	14: 21,660,841	I619F	probably damaging	Het
Kif26a	A	G	12: 112,178,147	R1612G	possibly damaging	Het
Kifc3	A	G	8: 95,110,692		probably null	Het
Krt39	A	T	11: 99,521,031	C76*	probably null	Het
Lcmt1	G	T	7: 123,401,495	R84L	probably benign	Het
Lrit1	A	G	14: 37,061,780	Y355C	probably benign	Het
Mad2l1	C	A	6: 66,535,413		probably null	Het
Med23	C	T	10: 24,902,448	T870M	probably damaging	Het
Mrpl2	A	G	17: 46,648,591		probably null	Het
Mtmr6	A	G	14: 60,300,445	D593G	probably benign	Het
Myo15b	G	A	11: 115,861,340	V683M		Het
Neb	T	A	2: 52,235,488	M506L		Het
Olfr103	T	C	17: 37,336,578	Y218C	probably benign	Het
Olfr103	A	G	17: 37,337,055	F59S	probably damaging	Het
Olfr1154	G	A	2: 87,903,193	T161I	probably benign	Het
Olfr434	T	A	6: 43,217,388	H158Q	possibly damaging	Het
Pdzd8	A	G	19: 59,327,863	F294L	probably damaging	Het
Rabgap1	G	A	2: 37,487,532	S347N	possibly damaging	Het
Rasgrf2	T	C	13: 91,896,082	T350A		Het
Rbp3	A	T	14: 33,954,158	H21L	probably benign	Het
Rp1	C	A	1: 4,142,658	V1069F	unknown	Het
Rtn4	T	A	11: 29,741,048	L1113*	probably null	Het
Ryr3	A	G	2: 112,775,695	F2407L	probably damaging	Het
Sept2	T	A	1: 93,497,444	D107E	probably damaging	Het
Sept4	A	G	11: 87,579,008	T7A	probably benign	Het
Slc34a3	T	A	2: 25,232,225	I123F	probably damaging	Het
Slc9a4	T	C	1: 40,600,776	Y243H	probably damaging	Het
Slco1a1	T	A	6: 141,943,388	E66V	probably damaging	Het
Spata33	A	G	8: 123,213,252	R68G	unknown	Het
Spta1	G	A	1: 174,202,451	D928N	probably damaging	Het
St8sia5	A	G	18: 77,254,550	S319G	probably benign	Het
Tmem208	A	G	8: 105,328,833	D149G	possibly damaging	Het
Trank1	A	T	9: 111,364,103	I583F	probably damaging	Het
Trio	C	T	15: 27,763,994	V2015M	probably damaging	Het
Tsc22d1	C	T	14: 76,416,701	Q207*	probably null	Het
Tshr	A	G	12: 91,505,305	D143G	probably benign	Het
Txlna	C	T	4: 129,632,157	R299H	probably damaging	Het
Ush2a	A	T	1: 188,444,592	T1318S	possibly damaging	Het
Utp14b	A	G	1: 78,664,943	K186R	probably damaging	Het
Vars2	C	T	17: 35,658,158	A884T	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp775	A	G	6: 48,619,249	Q19R	possibly damaging	Het

Other mutations in 3425401B19Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:3425401B19Rik	APN	14	32660916	missense	probably benign	0.18
IGL00844:3425401B19Rik	APN	14	32662999	nonsense	probably null
IGL01292:3425401B19Rik	APN	14	32660874	missense	probably benign	0.18
IGL01295:3425401B19Rik	APN	14	32661936	missense	possibly damaging	0.53
IGL01457:3425401B19Rik	APN	14	32660951	missense	probably benign
IGL01470:3425401B19Rik	APN	14	32660457	missense	possibly damaging	0.53
IGL01612:3425401B19Rik	APN	14	32660031	missense	possibly damaging	0.53
IGL01974:3425401B19Rik	APN	14	32659805	missense	possibly damaging	0.85
IGL02095:3425401B19Rik	APN	14	32661626	missense	probably benign	0.33
IGL02138:3425401B19Rik	APN	14	32662715	missense	possibly damaging	0.83
IGL02178:3425401B19Rik	APN	14	32662461	missense	possibly damaging	0.83
IGL02245:3425401B19Rik	APN	14	32659815	missense	probably benign	0.03
IGL02529:3425401B19Rik	APN	14	32661233	missense	probably benign
IGL03401:3425401B19Rik	APN	14	32662266	nonsense	probably null
PIT4515001:3425401B19Rik	UTSW	14	32661111	nonsense	probably null
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0233:3425401B19Rik	UTSW	14	32663373	missense	probably benign
R0320:3425401B19Rik	UTSW	14	32662614	missense	probably benign	0.19
R0519:3425401B19Rik	UTSW	14	32662962	missense	possibly damaging	0.92
R0551:3425401B19Rik	UTSW	14	32662641	missense	probably benign	0.03
R0759:3425401B19Rik	UTSW	14	32662497	missense	possibly damaging	0.93
R0831:3425401B19Rik	UTSW	14	32662271	missense	probably benign	0.01
R1124:3425401B19Rik	UTSW	14	32662082	missense	possibly damaging	0.53
R1346:3425401B19Rik	UTSW	14	32660814	missense	probably benign	0.07
R1997:3425401B19Rik	UTSW	14	32660048	missense	possibly damaging	0.71
R2055:3425401B19Rik	UTSW	14	32662551	missense	probably benign
R2212:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R2416:3425401B19Rik	UTSW	14	32663834	missense	probably benign	0.04
R2441:3425401B19Rik	UTSW	14	32663492	missense	possibly damaging	0.53
R2513:3425401B19Rik	UTSW	14	32661852	missense	possibly damaging	0.53
R3414:3425401B19Rik	UTSW	14	32661602	missense	probably benign	0.33
R3800:3425401B19Rik	UTSW	14	32663068	missense	possibly damaging	0.83
R3809:3425401B19Rik	UTSW	14	32663693	missense	possibly damaging	0.96
R4166:3425401B19Rik	UTSW	14	32660955	missense	possibly damaging	0.53
R4581:3425401B19Rik	UTSW	14	32661871	missense	possibly damaging	0.73
R4721:3425401B19Rik	UTSW	14	32663150	missense	probably benign	0.01
R4769:3425401B19Rik	UTSW	14	32660217	missense	probably benign	0.32
R4809:3425401B19Rik	UTSW	14	32662631	missense	probably benign	0.19
R4919:3425401B19Rik	UTSW	14	32663288	missense	possibly damaging	0.85
R4925:3425401B19Rik	UTSW	14	32663180	missense	possibly damaging	0.86
R4972:3425401B19Rik	UTSW	14	32661404	missense	possibly damaging	0.73
R5068:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5069:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5070:3425401B19Rik	UTSW	14	32661792	missense	possibly damaging	0.73
R5258:3425401B19Rik	UTSW	14	32663309	missense	probably damaging	0.98
R5435:3425401B19Rik	UTSW	14	32661456	missense	probably benign	0.18
R5549:3425401B19Rik	UTSW	14	32663036	missense	possibly damaging	0.68
R5678:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5680:3425401B19Rik	UTSW	14	32662053	missense	probably damaging	0.97
R5872:3425401B19Rik	UTSW	14	32660352	missense	possibly damaging	0.73
R5896:3425401B19Rik	UTSW	14	32661675	nonsense	probably null
R5940:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6044:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R6136:3425401B19Rik	UTSW	14	32662282	missense	possibly damaging	0.70
R6277:3425401B19Rik	UTSW	14	32663694	missense	possibly damaging	0.86
R6385:3425401B19Rik	UTSW	14	32661279	missense	probably benign	0.01
R6728:3425401B19Rik	UTSW	14	32662688	missense	possibly damaging	0.91
R6984:3425401B19Rik	UTSW	14	32661980	missense	probably benign	0.00
R7047:3425401B19Rik	UTSW	14	32660174	missense	possibly damaging	0.89
R7249:3425401B19Rik	UTSW	14	32663314	missense	possibly damaging	0.73
R7493:3425401B19Rik	UTSW	14	32663300	missense	possibly damaging	0.96
R7575:3425401B19Rik	UTSW	14	32662632	missense	probably benign	0.03
R7742:3425401B19Rik	UTSW	14	32662757	missense	possibly damaging	0.68
R7747:3425401B19Rik	UTSW	14	32663069	missense	possibly damaging	0.83
R8098:3425401B19Rik	UTSW	14	32662661	missense	probably damaging	0.99
R8111:3425401B19Rik	UTSW	14	32660309	nonsense	probably null
R8171:3425401B19Rik	UTSW	14	32662025	missense	probably benign
R8276:3425401B19Rik	UTSW	14	32663928	missense	probably damaging	0.97
R8330:3425401B19Rik	UTSW	14	32659793	missense	probably damaging	0.98
R8422:3425401B19Rik	UTSW	14	32662297	missense	possibly damaging	0.84
R8464:3425401B19Rik	UTSW	14	32659977	missense	possibly damaging	0.53
R8880:3425401B19Rik	UTSW	14	32660880	missense	probably benign	0.33
R8898:3425401B19Rik	UTSW	14	32661044	nonsense	probably null
R8911:3425401B19Rik	UTSW	14	32661669	missense	possibly damaging	0.53
R8934:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R9094:3425401B19Rik	UTSW	14	32660657	missense	possibly damaging	0.53
R9399:3425401B19Rik	UTSW	14	32662658	missense	probably damaging	0.98
R9435:3425401B19Rik	UTSW	14	32660605	missense	probably benign	0.08
R9485:3425401B19Rik	UTSW	14	32661443	missense	possibly damaging	0.85
R9766:3425401B19Rik	UTSW	14	32663831	missense	probably benign	0.00
X0025:3425401B19Rik	UTSW	14	32662469	missense	probably damaging	0.98
Z1177:3425401B19Rik	UTSW	14	32659808	missense	possibly damaging	0.86
Z1177:3425401B19Rik	UTSW	14	32661398	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGATCTCAAATGGCTAAGTATGAG -3'
(R):5'- TGCCTGTGACTTCCGTGATG -3'

Sequencing Primer
(F):5'- ATGGCTAAGTATGAGTTGAAATGTG -3'
(R):5'- GACTTCCGTGATGCCCCTG -3'

Posted On

2019-11-26