Incidental Mutation 'R7784:3425401B19Rik'
ID599465
Institutional Source Beutler Lab
Gene Symbol 3425401B19Rik
Ensembl Gene ENSMUSG00000071540
Gene NameRIKEN cDNA 3425401B19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7784 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32659119-32685293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32659840 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1389 (S1389R)
Ref Sequence ENSEMBL: ENSMUSP00000093741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096038]
Predicted Effect probably benign
Transcript: ENSMUST00000096038
AA Change: S1389R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000093741
Gene: ENSMUSG00000071540
AA Change: S1389R

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 386 399 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
low complexity region 605 624 N/A INTRINSIC
low complexity region 728 744 N/A INTRINSIC
low complexity region 1002 1015 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1147 1158 N/A INTRINSIC
low complexity region 1161 1176 N/A INTRINSIC
Pfam:DUF4585 1251 1322 6.5e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,182,828 probably null Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
C130026I21Rik T A 1: 85,212,474 probably null Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Mad2l1 C A 6: 66,535,413 probably null Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mrpl2 A G 17: 46,648,591 probably null Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in 3425401B19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:3425401B19Rik APN 14 32660916 missense probably benign 0.18
IGL00844:3425401B19Rik APN 14 32662999 nonsense probably null
IGL01292:3425401B19Rik APN 14 32660874 missense probably benign 0.18
IGL01295:3425401B19Rik APN 14 32661936 missense possibly damaging 0.53
IGL01457:3425401B19Rik APN 14 32660951 missense probably benign
IGL01470:3425401B19Rik APN 14 32660457 missense possibly damaging 0.53
IGL01612:3425401B19Rik APN 14 32660031 missense possibly damaging 0.53
IGL01974:3425401B19Rik APN 14 32659805 missense possibly damaging 0.85
IGL02095:3425401B19Rik APN 14 32661626 missense probably benign 0.33
IGL02138:3425401B19Rik APN 14 32662715 missense possibly damaging 0.83
IGL02178:3425401B19Rik APN 14 32662461 missense possibly damaging 0.83
IGL02245:3425401B19Rik APN 14 32659815 missense probably benign 0.03
IGL02529:3425401B19Rik APN 14 32661233 missense probably benign
IGL03401:3425401B19Rik APN 14 32662266 nonsense probably null
PIT4515001:3425401B19Rik UTSW 14 32661111 nonsense probably null
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0233:3425401B19Rik UTSW 14 32663373 missense probably benign
R0320:3425401B19Rik UTSW 14 32662614 missense probably benign 0.19
R0519:3425401B19Rik UTSW 14 32662962 missense possibly damaging 0.92
R0551:3425401B19Rik UTSW 14 32662641 missense probably benign 0.03
R0759:3425401B19Rik UTSW 14 32662497 missense possibly damaging 0.93
R0831:3425401B19Rik UTSW 14 32662271 missense probably benign 0.01
R1124:3425401B19Rik UTSW 14 32662082 missense possibly damaging 0.53
R1346:3425401B19Rik UTSW 14 32660814 missense probably benign 0.07
R1997:3425401B19Rik UTSW 14 32660048 missense possibly damaging 0.71
R2055:3425401B19Rik UTSW 14 32662551 missense probably benign
R2212:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R2416:3425401B19Rik UTSW 14 32663834 missense probably benign 0.04
R2441:3425401B19Rik UTSW 14 32663492 missense possibly damaging 0.53
R2513:3425401B19Rik UTSW 14 32661852 missense possibly damaging 0.53
R3414:3425401B19Rik UTSW 14 32661602 missense probably benign 0.33
R3800:3425401B19Rik UTSW 14 32663068 missense possibly damaging 0.83
R3809:3425401B19Rik UTSW 14 32663693 missense possibly damaging 0.96
R4166:3425401B19Rik UTSW 14 32660955 missense possibly damaging 0.53
R4581:3425401B19Rik UTSW 14 32661871 missense possibly damaging 0.73
R4721:3425401B19Rik UTSW 14 32663150 missense probably benign 0.01
R4769:3425401B19Rik UTSW 14 32660217 missense probably benign 0.32
R4809:3425401B19Rik UTSW 14 32662631 missense probably benign 0.19
R4919:3425401B19Rik UTSW 14 32663288 missense possibly damaging 0.85
R4925:3425401B19Rik UTSW 14 32663180 missense possibly damaging 0.86
R4972:3425401B19Rik UTSW 14 32661404 missense possibly damaging 0.73
R5068:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5069:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5070:3425401B19Rik UTSW 14 32661792 missense possibly damaging 0.73
R5258:3425401B19Rik UTSW 14 32663309 missense probably damaging 0.98
R5435:3425401B19Rik UTSW 14 32661456 missense probably benign 0.18
R5549:3425401B19Rik UTSW 14 32663036 missense possibly damaging 0.68
R5678:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5680:3425401B19Rik UTSW 14 32662053 missense probably damaging 0.97
R5872:3425401B19Rik UTSW 14 32660352 missense possibly damaging 0.73
R5896:3425401B19Rik UTSW 14 32661675 nonsense probably null
R5940:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6044:3425401B19Rik UTSW 14 32660657 missense possibly damaging 0.53
R6136:3425401B19Rik UTSW 14 32662282 missense possibly damaging 0.70
R6277:3425401B19Rik UTSW 14 32663694 missense possibly damaging 0.86
R6385:3425401B19Rik UTSW 14 32661279 missense probably benign 0.01
R6728:3425401B19Rik UTSW 14 32662688 missense possibly damaging 0.91
R6984:3425401B19Rik UTSW 14 32661980 missense probably benign 0.00
R7047:3425401B19Rik UTSW 14 32660174 missense possibly damaging 0.89
R7249:3425401B19Rik UTSW 14 32663314 missense possibly damaging 0.73
R7493:3425401B19Rik UTSW 14 32663300 missense possibly damaging 0.96
R7575:3425401B19Rik UTSW 14 32662632 missense probably benign 0.03
R7742:3425401B19Rik UTSW 14 32662757 missense possibly damaging 0.68
R7747:3425401B19Rik UTSW 14 32663069 missense possibly damaging 0.83
R8098:3425401B19Rik UTSW 14 32662661 missense probably damaging 0.99
R8111:3425401B19Rik UTSW 14 32660309 nonsense probably null
R8171:3425401B19Rik UTSW 14 32662025 missense probably benign
R8276:3425401B19Rik UTSW 14 32663928 missense probably damaging 0.97
R8330:3425401B19Rik UTSW 14 32659793 missense probably damaging 0.98
R8422:3425401B19Rik UTSW 14 32662297 missense possibly damaging 0.84
X0025:3425401B19Rik UTSW 14 32662469 missense probably damaging 0.98
Z1177:3425401B19Rik UTSW 14 32659808 missense possibly damaging 0.86
Z1177:3425401B19Rik UTSW 14 32661398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGATCTCAAATGGCTAAGTATGAG -3'
(R):5'- TGCCTGTGACTTCCGTGATG -3'

Sequencing Primer
(F):5'- ATGGCTAAGTATGAGTTGAAATGTG -3'
(R):5'- GACTTCCGTGATGCCCCTG -3'
Posted On2019-11-26