Incidental Mutation 'R7784:Vars2'
ID599472
Institutional Source Beutler Lab
Gene Symbol Vars2
Ensembl Gene ENSMUSG00000038838
Gene Namevalyl-tRNA synthetase 2, mitochondrial
SynonymsVars2l
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7784 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35655634-35667592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35658158 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 884 (A884T)
Ref Sequence ENSEMBL: ENSMUSP00000047917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043674] [ENSMUST00000169093]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043674
AA Change: A884T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838
AA Change: A884T

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164404
SMART Domains Protein: ENSMUSP00000126084
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 201 1e-49 PFAM
Pfam:tRNA-synt_1g 68 172 4e-7 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000129196
Gene: ENSMUSG00000038838
AA Change: A533T

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 2 386 3e-105 PFAM
Pfam:Anticodon_1 430 566 8.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169093
SMART Domains Protein: ENSMUSP00000126794
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 109 1.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr103 T C 17: 37,336,578 Y218C probably benign Het
Olfr103 A G 17: 37,337,055 F59S probably damaging Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Vars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Vars2 APN 17 35664621 unclassified probably benign
IGL02320:Vars2 APN 17 35660454 missense probably benign 0.07
IGL02580:Vars2 APN 17 35660885 missense possibly damaging 0.50
IGL02691:Vars2 APN 17 35660248 missense probably damaging 1.00
IGL03039:Vars2 APN 17 35664121 missense probably damaging 1.00
PIT4445001:Vars2 UTSW 17 35666211 nonsense probably null
R0079:Vars2 UTSW 17 35659156 missense probably damaging 0.99
R0152:Vars2 UTSW 17 35660027 missense probably damaging 1.00
R0346:Vars2 UTSW 17 35664864 unclassified probably benign
R0426:Vars2 UTSW 17 35664584 missense probably damaging 1.00
R0584:Vars2 UTSW 17 35666686 missense possibly damaging 0.82
R0589:Vars2 UTSW 17 35659176 missense probably benign
R0882:Vars2 UTSW 17 35657299 missense probably benign 0.41
R1234:Vars2 UTSW 17 35667146 missense probably damaging 1.00
R1263:Vars2 UTSW 17 35661609 missense probably damaging 1.00
R1559:Vars2 UTSW 17 35666258 unclassified probably benign
R1772:Vars2 UTSW 17 35660084 missense probably damaging 1.00
R1809:Vars2 UTSW 17 35662216 missense probably damaging 1.00
R1913:Vars2 UTSW 17 35666922 missense probably benign 0.02
R1986:Vars2 UTSW 17 35660061 missense probably damaging 1.00
R2504:Vars2 UTSW 17 35664793 missense probably damaging 1.00
R3426:Vars2 UTSW 17 35661974 missense probably damaging 1.00
R4539:Vars2 UTSW 17 35666888 missense probably damaging 0.99
R4751:Vars2 UTSW 17 35659343 missense possibly damaging 0.89
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R5028:Vars2 UTSW 17 35659473 critical splice donor site probably null
R5217:Vars2 UTSW 17 35658149 missense probably damaging 1.00
R5292:Vars2 UTSW 17 35660786 missense probably damaging 1.00
R6056:Vars2 UTSW 17 35665788 missense probably benign 0.01
R6211:Vars2 UTSW 17 35665662 unclassified probably null
R6213:Vars2 UTSW 17 35660440 missense probably benign 0.27
R6374:Vars2 UTSW 17 35660045 missense probably damaging 1.00
R6746:Vars2 UTSW 17 35660402 critical splice donor site probably null
R6749:Vars2 UTSW 17 35666713 missense probably damaging 1.00
R6957:Vars2 UTSW 17 35667075 missense probably benign 0.39
R7107:Vars2 UTSW 17 35658250 missense probably damaging 1.00
R7428:Vars2 UTSW 17 35666686 missense probably benign 0.00
R7538:Vars2 UTSW 17 35660780 missense probably damaging 1.00
R7553:Vars2 UTSW 17 35664788 missense possibly damaging 0.93
R7741:Vars2 UTSW 17 35660943 missense probably damaging 1.00
R7823:Vars2 UTSW 17 35659136 missense probably damaging 1.00
X0021:Vars2 UTSW 17 35659034 missense possibly damaging 0.93
Z1176:Vars2 UTSW 17 35664791 missense possibly damaging 0.55
Z1177:Vars2 UTSW 17 35663472 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCAATTCAGTGACACAGCATC -3'
(R):5'- TGAAGCCAGTGTTGTCGAG -3'

Sequencing Primer
(F):5'- AATCCTAGCACTTACTTGGGAGGC -3'
(R):5'- CCAGTGTTGTCGAGCGTGC -3'
Posted On2019-11-26