Incidental Mutation 'R7784:Olfr103'
ID599473
Institutional Source Beutler Lab
Gene Symbol Olfr103
Ensembl Gene ENSMUSG00000049618
Gene Nameolfactory receptor 103
SynonymsMOR250-3, GA_x6K02T2PSCP-1798423-1797482, MOR250-8_p
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7784 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37334303-37339698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37336578 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 218 (Y218C)
Ref Sequence ENSEMBL: ENSMUSP00000134539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058826] [ENSMUST00000173472]
Predicted Effect probably benign
Transcript: ENSMUST00000058826
AA Change: Y218C

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000094934
Gene: ENSMUSG00000049618
AA Change: Y218C

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 3.5e-52 PFAM
Pfam:7tm_1 39 289 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173472
AA Change: Y218C

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134539
Gene: ENSMUSG00000049618
AA Change: Y218C

DomainStartEndE-ValueType
Pfam:7tm_1 39 289 2.8e-31 PFAM
Pfam:7tm_4 137 282 1.1e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,659,840 S1389R probably benign Het
Abca9 A T 11: 110,154,417 C363* probably null Het
Actbl2 T A 13: 111,255,411 N93K probably damaging Het
Adamtsl3 T C 7: 82,573,989 Y993H probably damaging Het
Adgrg1 G A 8: 95,012,882 W653* probably null Het
Akap13 T A 7: 75,610,328 V97D probably benign Het
Cacna1d T A 14: 30,123,439 D613V probably damaging Het
Col10a1 C A 10: 34,394,218 P62H unknown Het
Cpb2 A T 14: 75,275,040 N298Y probably damaging Het
Ddc A G 11: 11,839,396 probably null Het
Ddx6 T C 9: 44,630,142 probably null Het
Epb42 T G 2: 121,034,435 K58N probably benign Het
Eps8 T A 6: 137,499,587 I605L probably benign Het
Eps8l1 T C 7: 4,472,122 L304P probably damaging Het
Erbb4 T A 1: 68,075,499 I929F probably damaging Het
Erc2 A T 14: 27,898,594 N393I probably damaging Het
Fbxw25 C T 9: 109,650,119 D355N Het
Ffar2 T C 7: 30,819,258 K286E probably benign Het
Gabrd A G 4: 155,388,932 probably null Het
Ganc G A 2: 120,436,668 W488* probably null Het
Gm5724 C T 6: 141,713,193 probably null Het
Ifi207 T A 1: 173,730,132 M347L unknown Het
Kat6b A T 14: 21,660,841 I619F probably damaging Het
Kif26a A G 12: 112,178,147 R1612G possibly damaging Het
Kifc3 A G 8: 95,110,692 probably null Het
Krt39 A T 11: 99,521,031 C76* probably null Het
Lcmt1 G T 7: 123,401,495 R84L probably benign Het
Lrit1 A G 14: 37,061,780 Y355C probably benign Het
Med23 C T 10: 24,902,448 T870M probably damaging Het
Mtmr6 A G 14: 60,300,445 D593G probably benign Het
Myo15b G A 11: 115,861,340 V683M Het
Neb T A 2: 52,235,488 M506L Het
Olfr1154 G A 2: 87,903,193 T161I probably benign Het
Olfr434 T A 6: 43,217,388 H158Q possibly damaging Het
Pdzd8 A G 19: 59,327,863 F294L probably damaging Het
Rabgap1 G A 2: 37,487,532 S347N possibly damaging Het
Rasgrf2 T C 13: 91,896,082 T350A Het
Rbp3 A T 14: 33,954,158 H21L probably benign Het
Rp1 C A 1: 4,142,658 V1069F unknown Het
Rtn4 T A 11: 29,741,048 L1113* probably null Het
Ryr3 A G 2: 112,775,695 F2407L probably damaging Het
Sept2 T A 1: 93,497,444 D107E probably damaging Het
Sept4 A G 11: 87,579,008 T7A probably benign Het
Slc34a3 T A 2: 25,232,225 I123F probably damaging Het
Slc9a4 T C 1: 40,600,776 Y243H probably damaging Het
Slco1a1 T A 6: 141,943,388 E66V probably damaging Het
Spata33 A G 8: 123,213,252 R68G unknown Het
Spta1 G A 1: 174,202,451 D928N probably damaging Het
St8sia5 A G 18: 77,254,550 S319G probably benign Het
Tmem208 A G 8: 105,328,833 D149G possibly damaging Het
Trank1 A T 9: 111,364,103 I583F probably damaging Het
Trio C T 15: 27,763,994 V2015M probably damaging Het
Tsc22d1 C T 14: 76,416,701 Q207* probably null Het
Tshr A G 12: 91,505,305 D143G probably benign Het
Txlna C T 4: 129,632,157 R299H probably damaging Het
Ush2a A T 1: 188,444,592 T1318S possibly damaging Het
Utp14b A G 1: 78,664,943 K186R probably damaging Het
Vars2 C T 17: 35,658,158 A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp775 A G 6: 48,619,249 Q19R possibly damaging Het
Other mutations in Olfr103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Olfr103 APN 17 37336583 nonsense probably null
IGL01953:Olfr103 APN 17 37336875 missense probably damaging 1.00
IGL02556:Olfr103 APN 17 37336996 missense probably benign 0.00
IGL02574:Olfr103 APN 17 37336524 missense probably damaging 1.00
IGL02737:Olfr103 APN 17 37336773 missense possibly damaging 0.94
IGL02995:Olfr103 APN 17 37336709 missense probably damaging 1.00
R1078:Olfr103 UTSW 17 37337026 missense probably damaging 0.98
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R3024:Olfr103 UTSW 17 37337027 missense probably damaging 1.00
R3858:Olfr103 UTSW 17 37337226 nonsense probably null
R4979:Olfr103 UTSW 17 37336868 missense probably benign 0.06
R5062:Olfr103 UTSW 17 37336931 missense probably damaging 0.99
R5215:Olfr103 UTSW 17 37336813 missense probably benign 0.00
R5441:Olfr103 UTSW 17 37336268 unclassified probably null
R5453:Olfr103 UTSW 17 37337062 missense possibly damaging 0.96
R5525:Olfr103 UTSW 17 37336626 missense probably damaging 0.99
R5660:Olfr103 UTSW 17 37336644 missense probably damaging 1.00
R5859:Olfr103 UTSW 17 37336369 missense possibly damaging 0.61
R6211:Olfr103 UTSW 17 37336708 missense possibly damaging 0.90
R6958:Olfr103 UTSW 17 37336417 missense probably benign
R7060:Olfr103 UTSW 17 37336461 missense probably benign 0.02
R7567:Olfr103 UTSW 17 37337171 missense probably benign 0.00
R7784:Olfr103 UTSW 17 37337055 missense probably damaging 0.99
Z1088:Olfr103 UTSW 17 37336705 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATGATGGCAATGATTCTGTC -3'
(R):5'- GTGACCATCTGGACCATTGC -3'

Sequencing Primer
(F):5'- CTGTCCTGGTCTAAAGAGCTGC -3'
(R):5'- TCTGTAATGACATCTCGTTTGAGC -3'
Posted On2019-11-26