Incidental Mutation 'R7784:Pdzd8'
ID 599476
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene Name PDZ domain containing 8
Synonyms Pdzk8, A630041P07Rik
MMRRC Submission 045840-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7784 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 59285610-59334212 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59316295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 294 (F294L)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
AlphaFold B9EJ80
Predicted Effect probably damaging
Transcript: ENSMUST00000099274
AA Change: F294L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: F294L

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,119,638 (GRCm39) probably null Het
3425401B19Rik A T 14: 32,381,797 (GRCm39) S1389R probably benign Het
Abca9 A T 11: 110,045,243 (GRCm39) C363* probably null Het
Actbl2 T A 13: 111,391,945 (GRCm39) N93K probably damaging Het
Adamtsl3 T C 7: 82,223,197 (GRCm39) Y993H probably damaging Het
Adgrg1 G A 8: 95,739,510 (GRCm39) W653* probably null Het
Akap13 T A 7: 75,260,076 (GRCm39) V97D probably benign Het
Cacna1d T A 14: 29,845,396 (GRCm39) D613V probably damaging Het
Col10a1 C A 10: 34,270,214 (GRCm39) P62H unknown Het
Cpb2 A T 14: 75,512,480 (GRCm39) N298Y probably damaging Het
Ddc A G 11: 11,789,396 (GRCm39) probably null Het
Ddx6 T C 9: 44,541,439 (GRCm39) probably null Het
Epb42 T G 2: 120,864,916 (GRCm39) K58N probably benign Het
Eps8 T A 6: 137,476,585 (GRCm39) I605L probably benign Het
Eps8l1 T C 7: 4,475,121 (GRCm39) L304P probably damaging Het
Erbb4 T A 1: 68,114,658 (GRCm39) I929F probably damaging Het
Erc2 A T 14: 27,620,551 (GRCm39) N393I probably damaging Het
Fbxw25 C T 9: 109,479,187 (GRCm39) D355N Het
Ffar2 T C 7: 30,518,683 (GRCm39) K286E probably benign Het
Gabrd A G 4: 155,473,389 (GRCm39) probably null Het
Ganc G A 2: 120,267,149 (GRCm39) W488* probably null Het
Ifi207 T A 1: 173,557,698 (GRCm39) M347L unknown Het
Kat6b A T 14: 21,710,909 (GRCm39) I619F probably damaging Het
Kif26a A G 12: 112,144,581 (GRCm39) R1612G possibly damaging Het
Kifc3 A G 8: 95,837,320 (GRCm39) probably null Het
Krt39 A T 11: 99,411,857 (GRCm39) C76* probably null Het
Lcmt1 G T 7: 123,000,718 (GRCm39) R84L probably benign Het
Lrit1 A G 14: 36,783,737 (GRCm39) Y355C probably benign Het
Mad2l1 C A 6: 66,512,397 (GRCm39) probably null Het
Med23 C T 10: 24,778,346 (GRCm39) T870M probably damaging Het
Mrpl2 A G 17: 46,959,517 (GRCm39) probably null Het
Mtmr6 A G 14: 60,537,894 (GRCm39) D593G probably benign Het
Myo15b G A 11: 115,752,166 (GRCm39) V683M Het
Neb T A 2: 52,125,500 (GRCm39) M506L Het
Or12d13 T C 17: 37,647,469 (GRCm39) Y218C probably benign Het
Or12d13 A G 17: 37,647,946 (GRCm39) F59S probably damaging Het
Or2a20 T A 6: 43,194,322 (GRCm39) H158Q possibly damaging Het
Or9m1 G A 2: 87,733,537 (GRCm39) T161I probably benign Het
Rabgap1 G A 2: 37,377,544 (GRCm39) S347N possibly damaging Het
Rasgrf2 T C 13: 92,044,201 (GRCm39) T350A Het
Rbp3 A T 14: 33,676,115 (GRCm39) H21L probably benign Het
Rp1 C A 1: 4,212,881 (GRCm39) V1069F unknown Het
Rtn4 T A 11: 29,691,048 (GRCm39) L1113* probably null Het
Ryr3 A G 2: 112,606,040 (GRCm39) F2407L probably damaging Het
Septin2 T A 1: 93,425,166 (GRCm39) D107E probably damaging Het
Septin4 A G 11: 87,469,834 (GRCm39) T7A probably benign Het
Slc34a3 T A 2: 25,122,237 (GRCm39) I123F probably damaging Het
Slc9a4 T C 1: 40,639,936 (GRCm39) Y243H probably damaging Het
Slco1a1 T A 6: 141,889,114 (GRCm39) E66V probably damaging Het
Slco1a7 C T 6: 141,658,919 (GRCm39) probably null Het
Sp140l2 T A 1: 85,190,195 (GRCm39) probably null Het
Spata33 A G 8: 123,939,991 (GRCm39) R68G unknown Het
Spta1 G A 1: 174,030,017 (GRCm39) D928N probably damaging Het
St8sia5 A G 18: 77,342,246 (GRCm39) S319G probably benign Het
Tmem208 A G 8: 106,055,465 (GRCm39) D149G possibly damaging Het
Trank1 A T 9: 111,193,171 (GRCm39) I583F probably damaging Het
Trio C T 15: 27,764,080 (GRCm39) V2015M probably damaging Het
Tsc22d1 C T 14: 76,654,141 (GRCm39) Q207* probably null Het
Tshr A G 12: 91,472,079 (GRCm39) D143G probably benign Het
Txlna C T 4: 129,525,950 (GRCm39) R299H probably damaging Het
Ush2a A T 1: 188,176,789 (GRCm39) T1318S possibly damaging Het
Utp14b A G 1: 78,642,660 (GRCm39) K186R probably damaging Het
Vars2 C T 17: 35,969,050 (GRCm39) A884T possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp775 A G 6: 48,596,183 (GRCm39) Q19R possibly damaging Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59,288,218 (GRCm39) missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59,289,961 (GRCm39) missense probably benign
IGL01865:Pdzd8 APN 19 59,288,077 (GRCm39) missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59,303,724 (GRCm39) missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59,288,922 (GRCm39) missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59,289,060 (GRCm39) missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59,289,825 (GRCm39) missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59,288,215 (GRCm39) nonsense probably null
IGL02713:Pdzd8 APN 19 59,333,890 (GRCm39) missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59,288,804 (GRCm39) nonsense probably null
IGL02966:Pdzd8 APN 19 59,289,291 (GRCm39) missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59,288,940 (GRCm39) missense probably damaging 1.00
citadel UTSW 19 59,287,957 (GRCm39) makesense probably null
Eleventh_hour UTSW 19 59,293,662 (GRCm39) missense probably damaging 1.00
keep UTSW 19 59,289,783 (GRCm39) nonsense probably null
Stronghold UTSW 19 59,333,784 (GRCm39) nonsense probably null
R0018:Pdzd8 UTSW 19 59,289,105 (GRCm39) missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59,288,028 (GRCm39) missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59,289,563 (GRCm39) missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59,288,811 (GRCm39) missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59,288,811 (GRCm39) missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59,289,361 (GRCm39) missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59,333,365 (GRCm39) missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59,288,904 (GRCm39) missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59,289,771 (GRCm39) missense probably benign
R1965:Pdzd8 UTSW 19 59,288,554 (GRCm39) missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59,288,853 (GRCm39) missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59,293,588 (GRCm39) critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59,333,845 (GRCm39) missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59,288,560 (GRCm39) missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59,333,913 (GRCm39) missense probably benign
R4504:Pdzd8 UTSW 19 59,333,880 (GRCm39) missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59,293,662 (GRCm39) missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59,333,743 (GRCm39) missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59,289,292 (GRCm39) missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59,289,236 (GRCm39) nonsense probably null
R5176:Pdzd8 UTSW 19 59,333,389 (GRCm39) missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59,289,458 (GRCm39) missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59,288,057 (GRCm39) missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59,288,972 (GRCm39) missense possibly damaging 0.65
R5903:Pdzd8 UTSW 19 59,333,718 (GRCm39) missense possibly damaging 0.58
R6036:Pdzd8 UTSW 19 59,293,641 (GRCm39) missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59,293,641 (GRCm39) missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59,288,994 (GRCm39) missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59,289,415 (GRCm39) missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59,333,298 (GRCm39) missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59,289,801 (GRCm39) missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59,287,957 (GRCm39) makesense probably null
R6902:Pdzd8 UTSW 19 59,289,829 (GRCm39) missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59,333,784 (GRCm39) nonsense probably null
R7088:Pdzd8 UTSW 19 59,333,389 (GRCm39) missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59,288,125 (GRCm39) missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59,288,589 (GRCm39) missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59,333,571 (GRCm39) missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59,289,077 (GRCm39) missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59,289,783 (GRCm39) nonsense probably null
R7699:Pdzd8 UTSW 19 59,333,373 (GRCm39) missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59,333,208 (GRCm39) missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59,288,358 (GRCm39) missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59,333,518 (GRCm39) missense probably damaging 0.96
R9364:Pdzd8 UTSW 19 59,333,574 (GRCm39) missense probably damaging 1.00
R9368:Pdzd8 UTSW 19 59,289,219 (GRCm39) nonsense probably null
R9406:Pdzd8 UTSW 19 59,333,245 (GRCm39) missense
R9548:Pdzd8 UTSW 19 59,289,826 (GRCm39) missense probably benign 0.13
R9554:Pdzd8 UTSW 19 59,333,574 (GRCm39) missense probably damaging 1.00
R9688:Pdzd8 UTSW 19 59,333,683 (GRCm39) missense probably benign 0.05
R9750:Pdzd8 UTSW 19 59,289,684 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAAACTGGAAAAGACTGC -3'
(R):5'- AAGTGTCCTGGGCTTGTCAG -3'

Sequencing Primer
(F):5'- AGAGCAGAATAAACATAAACAGTCC -3'
(R):5'- GGGCTTGTCAGTAATTACCTTCCAG -3'
Posted On 2019-11-26