Incidental Mutation 'R7785:Fam205c'
ID599486
Institutional Source Beutler Lab
Gene Symbol Fam205c
Ensembl Gene ENSMUSG00000050141
Gene Namefamily with sequence similarity 205, member C
SynonymsBC049635
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7785 (G1)
Quality Score150.466
Status Not validated
Chromosome4
Chromosomal Location42868004-42874234 bp(-) (GRCm38)
Type of Mutationsmall deletion (11 aa in frame mutation)
DNA Base Change (assembly) TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG at 42871823 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055944] [ENSMUST00000107978]
Predicted Effect probably benign
Transcript: ENSMUST00000055944
SMART Domains Protein: ENSMUSP00000060318
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 51 139 2.7e-31 PFAM
internal_repeat_1 147 168 5.83e-10 PROSPERO
internal_repeat_1 180 201 5.83e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107978
SMART Domains Protein: ENSMUSP00000103612
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 52 138 3.4e-28 PFAM
internal_repeat_1 147 168 5.79e-10 PROSPERO
internal_repeat_1 180 201 5.79e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,613,193 F70L probably benign Het
Abca8a T C 11: 110,074,206 probably null Het
Adamts5 T C 16: 85,863,004 D800G probably damaging Het
Afm T C 5: 90,550,173 V478A possibly damaging Het
Akap7 T A 10: 25,220,661 K233M probably damaging Het
Apbb1 T C 7: 105,567,423 N61S probably benign Het
Atp8b1 A T 18: 64,556,850 S604T probably damaging Het
Bcl2l14 G T 6: 134,432,260 V266F possibly damaging Het
Btnl2 T A 17: 34,361,163 H223Q probably benign Het
Cap2 A G 13: 46,635,748 E255G probably benign Het
Chd6 A T 2: 160,970,175 F1366Y possibly damaging Het
Cryl1 A T 14: 57,275,481 S310T probably benign Het
Cyp2c69 A G 19: 39,851,166 C338R probably damaging Het
Dclre1c C T 2: 3,424,236 Q7* probably null Het
Dhcr7 A G 7: 143,845,472 E193G probably damaging Het
Dnmt1 T C 9: 20,922,049 K652E probably damaging Het
Emilin3 A T 2: 160,910,774 C85* probably null Het
Erp44 G A 4: 48,243,531 P26S probably benign Het
Fxr1 A G 3: 34,046,254 I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpc5 A G 14: 115,417,220 N484S probably benign Het
Grm8 A G 6: 27,618,637 V402A probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Iqgap1 A G 7: 80,738,169 L910P probably damaging Het
Klra2 A T 6: 131,245,290 F13I possibly damaging Het
Lmtk2 T C 5: 144,174,753 S764P probably benign Het
Ndufs1 T C 1: 63,147,399 D637G probably damaging Het
Nnmt G A 9: 48,592,009 S239F probably benign Het
Pdcd11 A G 19: 47,104,686 I468V probably benign Het
Pkhd1l1 T C 15: 44,543,569 W2401R probably damaging Het
Plec C A 15: 76,205,829 V104F unknown Het
Polq A G 16: 37,027,877 Y282C probably damaging Het
Ppp1r37 A T 7: 19,532,071 V590E probably damaging Het
Prr27 T C 5: 87,843,272 S248P probably benign Het
Ros1 T C 10: 52,162,848 E351G probably damaging Het
Scn11a T C 9: 119,816,556 I111V probably benign Het
Slc35a1 A G 4: 34,675,148 L130S probably damaging Het
Slc39a12 T C 2: 14,420,218 L420P probably damaging Het
Sp140 T A 1: 85,620,098 I182K probably benign Het
Trpv3 C A 11: 73,277,732 H42N probably benign Het
Wdr92 T A 11: 17,229,785 V262E probably damaging Het
Zan A G 5: 137,429,143 S2411P unknown Het
Other mutations in Fam205c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Fam205c APN 4 42868564 missense probably benign 0.40
IGL01697:Fam205c APN 4 42874163 missense probably benign
IGL02413:Fam205c APN 4 42868549 missense probably damaging 0.99
IGL02450:Fam205c APN 4 42874127 missense probably benign
R0433:Fam205c UTSW 4 42874013 splice site probably benign
R1580:Fam205c UTSW 4 42874020 splice site probably null
R2042:Fam205c UTSW 4 42874030 missense possibly damaging 0.96
R2102:Fam205c UTSW 4 42868558 missense probably benign 0.00
R3824:Fam205c UTSW 4 42873492 critical splice donor site probably null
R4192:Fam205c UTSW 4 42874185 utr 5 prime probably benign
R4668:Fam205c UTSW 4 42871608 missense probably benign 0.00
R4690:Fam205c UTSW 4 42873032 splice site probably null
R5743:Fam205c UTSW 4 42873087 missense probably damaging 0.99
R5868:Fam205c UTSW 4 42871711 missense probably damaging 0.96
R6186:Fam205c UTSW 4 42872000 missense possibly damaging 0.95
R6778:Fam205c UTSW 4 42868522 missense possibly damaging 0.94
R6986:Fam205c UTSW 4 42868696 missense possibly damaging 0.90
R7318:Fam205c UTSW 4 42871823 small deletion probably benign
R7413:Fam205c UTSW 4 42871823 small deletion probably benign
R7675:Fam205c UTSW 4 42871823 small deletion probably benign
R7842:Fam205c UTSW 4 42871823 small deletion probably benign
R8125:Fam205c UTSW 4 42873051 missense probably damaging 0.99
RF040:Fam205c UTSW 4 42871823 small deletion probably benign
X0052:Fam205c UTSW 4 42874047 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCCTGGAACGCATTTGACCC -3'
(R):5'- AGACCTCTTCCAGTCTACTGAG -3'

Sequencing Primer
(F):5'- AACGCATTTGACCCTTGAGG -3'
(R):5'- GGCACTCCCGCAGCTTTTC -3'
Posted On2019-11-26