Incidental Mutation 'R7785:Spata31f3'
ID 599486
Institutional Source Beutler Lab
Gene Symbol Spata31f3
Ensembl Gene ENSMUSG00000050141
Gene Name spermatogenesis associated 31 subfamily F member 3
Synonyms BC049635, Fam205c
MMRRC Submission 045841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R7785 (G1)
Quality Score 150.466
Status Not validated
Chromosome 4
Chromosomal Location 42868004-42874234 bp(-) (GRCm39)
Type of Mutation small deletion (11 aa in frame mutation)
DNA Base Change (assembly) TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG at 42871823 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055944] [ENSMUST00000107978]
AlphaFold Q80YD3
Predicted Effect probably benign
Transcript: ENSMUST00000055944
SMART Domains Protein: ENSMUSP00000060318
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 51 139 2.7e-31 PFAM
internal_repeat_1 147 168 5.83e-10 PROSPERO
internal_repeat_1 180 201 5.83e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107978
SMART Domains Protein: ENSMUSP00000103612
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 52 138 3.4e-28 PFAM
internal_repeat_1 147 168 5.79e-10 PROSPERO
internal_repeat_1 180 201 5.79e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,262,617 (GRCm39) F70L probably benign Het
Abca8a T C 11: 109,965,032 (GRCm39) probably null Het
Adamts5 T C 16: 85,659,892 (GRCm39) D800G probably damaging Het
Afm T C 5: 90,698,032 (GRCm39) V478A possibly damaging Het
Akap7 T A 10: 25,096,559 (GRCm39) K233M probably damaging Het
Apbb1 T C 7: 105,216,630 (GRCm39) N61S probably benign Het
Atp8b1 A T 18: 64,689,921 (GRCm39) S604T probably damaging Het
Bcl2l14 G T 6: 134,409,223 (GRCm39) V266F possibly damaging Het
Btnl2 T A 17: 34,580,137 (GRCm39) H223Q probably benign Het
Cap2 A G 13: 46,789,224 (GRCm39) E255G probably benign Het
Chd6 A T 2: 160,812,095 (GRCm39) F1366Y possibly damaging Het
Cryl1 A T 14: 57,512,938 (GRCm39) S310T probably benign Het
Cyp2c69 A G 19: 39,839,610 (GRCm39) C338R probably damaging Het
Dclre1c C T 2: 3,425,273 (GRCm39) Q7* probably null Het
Dhcr7 A G 7: 143,399,209 (GRCm39) E193G probably damaging Het
Dnaaf10 T A 11: 17,179,785 (GRCm39) V262E probably damaging Het
Dnmt1 T C 9: 20,833,345 (GRCm39) K652E probably damaging Het
Emilin3 A T 2: 160,752,694 (GRCm39) C85* probably null Het
Erp44 G A 4: 48,243,531 (GRCm39) P26S probably benign Het
Fxr1 A G 3: 34,100,403 (GRCm39) I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 141,794,171 (GRCm39) probably benign Het
Gpc5 A G 14: 115,654,632 (GRCm39) N484S probably benign Het
Grm8 A G 6: 27,618,636 (GRCm39) V402A probably damaging Het
Gstcd C T 3: 132,787,868 (GRCm39) V277M probably damaging Het
Iqgap1 A G 7: 80,387,917 (GRCm39) L910P probably damaging Het
Klra2 A T 6: 131,222,253 (GRCm39) F13I possibly damaging Het
Lmtk2 T C 5: 144,111,571 (GRCm39) S764P probably benign Het
Ndufs1 T C 1: 63,186,558 (GRCm39) D637G probably damaging Het
Nnmt G A 9: 48,503,309 (GRCm39) S239F probably benign Het
Pdcd11 A G 19: 47,093,125 (GRCm39) I468V probably benign Het
Pkhd1l1 T C 15: 44,406,965 (GRCm39) W2401R probably damaging Het
Plec C A 15: 76,090,029 (GRCm39) V104F unknown Het
Polq A G 16: 36,848,239 (GRCm39) Y282C probably damaging Het
Ppp1r37 A T 7: 19,265,996 (GRCm39) V590E probably damaging Het
Prr27 T C 5: 87,991,131 (GRCm39) S248P probably benign Het
Ros1 T C 10: 52,038,944 (GRCm39) E351G probably damaging Het
Scn11a T C 9: 119,645,622 (GRCm39) I111V probably benign Het
Slc35a1 A G 4: 34,675,148 (GRCm39) L130S probably damaging Het
Slc39a12 T C 2: 14,425,029 (GRCm39) L420P probably damaging Het
Sp140 T A 1: 85,547,819 (GRCm39) I182K probably benign Het
Trpv3 C A 11: 73,168,558 (GRCm39) H42N probably benign Het
Zan A G 5: 137,427,405 (GRCm39) S2411P unknown Het
Other mutations in Spata31f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Spata31f3 APN 4 42,868,564 (GRCm39) missense probably benign 0.40
IGL01697:Spata31f3 APN 4 42,874,163 (GRCm39) missense probably benign
IGL02413:Spata31f3 APN 4 42,868,549 (GRCm39) missense probably damaging 0.99
IGL02450:Spata31f3 APN 4 42,874,127 (GRCm39) missense probably benign
R0433:Spata31f3 UTSW 4 42,874,013 (GRCm39) splice site probably benign
R1580:Spata31f3 UTSW 4 42,874,020 (GRCm39) splice site probably null
R2042:Spata31f3 UTSW 4 42,874,030 (GRCm39) missense possibly damaging 0.96
R2102:Spata31f3 UTSW 4 42,868,558 (GRCm39) missense probably benign 0.00
R3824:Spata31f3 UTSW 4 42,873,492 (GRCm39) critical splice donor site probably null
R4192:Spata31f3 UTSW 4 42,874,185 (GRCm39) utr 5 prime probably benign
R4668:Spata31f3 UTSW 4 42,871,608 (GRCm39) missense probably benign 0.00
R4690:Spata31f3 UTSW 4 42,873,032 (GRCm39) splice site probably null
R5743:Spata31f3 UTSW 4 42,873,087 (GRCm39) missense probably damaging 0.99
R5868:Spata31f3 UTSW 4 42,871,711 (GRCm39) missense probably damaging 0.96
R6186:Spata31f3 UTSW 4 42,872,000 (GRCm39) missense possibly damaging 0.95
R6778:Spata31f3 UTSW 4 42,868,522 (GRCm39) missense possibly damaging 0.94
R6986:Spata31f3 UTSW 4 42,868,696 (GRCm39) missense possibly damaging 0.90
R7318:Spata31f3 UTSW 4 42,871,823 (GRCm39) small deletion probably benign
R7413:Spata31f3 UTSW 4 42,871,823 (GRCm39) small deletion probably benign
R7675:Spata31f3 UTSW 4 42,871,823 (GRCm39) small deletion probably benign
R7842:Spata31f3 UTSW 4 42,871,823 (GRCm39) small deletion probably benign
R8125:Spata31f3 UTSW 4 42,873,051 (GRCm39) missense probably damaging 0.99
R8808:Spata31f3 UTSW 4 42,871,823 (GRCm39) small deletion probably benign
R8954:Spata31f3 UTSW 4 42,871,753 (GRCm39) missense probably damaging 0.98
R9343:Spata31f3 UTSW 4 42,871,823 (GRCm39) small deletion probably benign
R9620:Spata31f3 UTSW 4 42,871,823 (GRCm39) small deletion probably benign
RF040:Spata31f3 UTSW 4 42,871,823 (GRCm39) small deletion probably benign
X0052:Spata31f3 UTSW 4 42,874,047 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCCTGGAACGCATTTGACCC -3'
(R):5'- AGACCTCTTCCAGTCTACTGAG -3'

Sequencing Primer
(F):5'- AACGCATTTGACCCTTGAGG -3'
(R):5'- GGCACTCCCGCAGCTTTTC -3'
Posted On 2019-11-26