Incidental Mutation 'R7785:Erp44'
ID599487
Institutional Source Beutler Lab
Gene Symbol Erp44
Ensembl Gene ENSMUSG00000028343
Gene Nameendoplasmic reticulum protein 44
Synonyms1110001E24Rik, Txndc4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7785 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48193323-48279558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48243531 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 26 (P26S)
Ref Sequence ENSEMBL: ENSMUSP00000030028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030028]
Predicted Effect probably benign
Transcript: ENSMUST00000030028
AA Change: P26S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030028
Gene: ENSMUSG00000028343
AA Change: P26S

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:Calsequestrin 29 205 6.4e-12 PFAM
Pfam:Thioredoxin 30 139 1.1e-23 PFAM
Pfam:Thioredoxin_6 167 350 8.6e-45 PFAM
Meta Mutation Damage Score 0.0675 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins. It has an inferred N-terminal signal peptide, a catalytically active thioredoxin (TRX) domain, two TRX-like domains and a C-terminal ER-retention sequence. This protein functions as a pH-regulated chaperone of the secretory pathway and likely plays a role in protein quality control at the endoplasmic reticulum - Golgi interface. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit light coat colour, small stature and scaly tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,613,193 F70L probably benign Het
Abca8a T C 11: 110,074,206 probably null Het
Adamts5 T C 16: 85,863,004 D800G probably damaging Het
Afm T C 5: 90,550,173 V478A possibly damaging Het
Akap7 T A 10: 25,220,661 K233M probably damaging Het
Apbb1 T C 7: 105,567,423 N61S probably benign Het
Atp8b1 A T 18: 64,556,850 S604T probably damaging Het
Bcl2l14 G T 6: 134,432,260 V266F possibly damaging Het
Btnl2 T A 17: 34,361,163 H223Q probably benign Het
Cap2 A G 13: 46,635,748 E255G probably benign Het
Chd6 A T 2: 160,970,175 F1366Y possibly damaging Het
Cryl1 A T 14: 57,275,481 S310T probably benign Het
Cyp2c69 A G 19: 39,851,166 C338R probably damaging Het
Dclre1c C T 2: 3,424,236 Q7* probably null Het
Dhcr7 A G 7: 143,845,472 E193G probably damaging Het
Dnmt1 T C 9: 20,922,049 K652E probably damaging Het
Emilin3 A T 2: 160,910,774 C85* probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fxr1 A G 3: 34,046,254 I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpc5 A G 14: 115,417,220 N484S probably benign Het
Grm8 A G 6: 27,618,637 V402A probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Iqgap1 A G 7: 80,738,169 L910P probably damaging Het
Klra2 A T 6: 131,245,290 F13I possibly damaging Het
Lmtk2 T C 5: 144,174,753 S764P probably benign Het
Ndufs1 T C 1: 63,147,399 D637G probably damaging Het
Nnmt G A 9: 48,592,009 S239F probably benign Het
Pdcd11 A G 19: 47,104,686 I468V probably benign Het
Pkhd1l1 T C 15: 44,543,569 W2401R probably damaging Het
Plec C A 15: 76,205,829 V104F unknown Het
Polq A G 16: 37,027,877 Y282C probably damaging Het
Ppp1r37 A T 7: 19,532,071 V590E probably damaging Het
Prr27 T C 5: 87,843,272 S248P probably benign Het
Ros1 T C 10: 52,162,848 E351G probably damaging Het
Scn11a T C 9: 119,816,556 I111V probably benign Het
Slc35a1 A G 4: 34,675,148 L130S probably damaging Het
Slc39a12 T C 2: 14,420,218 L420P probably damaging Het
Sp140 T A 1: 85,620,098 I182K probably benign Het
Trpv3 C A 11: 73,277,732 H42N probably benign Het
Wdr92 T A 11: 17,229,785 V262E probably damaging Het
Zan A G 5: 137,429,143 S2411P unknown Het
Other mutations in Erp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Erp44 APN 4 48218126 missense probably benign 0.22
IGL02057:Erp44 APN 4 48236964 missense probably benign 0.05
IGL03165:Erp44 APN 4 48236872 critical splice donor site probably null
IGL03253:Erp44 APN 4 48208750 missense probably benign 0.09
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R0033:Erp44 UTSW 4 48241289 splice site probably benign
R4976:Erp44 UTSW 4 48208797 missense probably benign 0.01
R5024:Erp44 UTSW 4 48241296 nonsense probably null
R5175:Erp44 UTSW 4 48196823 missense probably benign 0.41
R5224:Erp44 UTSW 4 48279435 missense probably benign
R5359:Erp44 UTSW 4 48211704 missense probably benign
R6128:Erp44 UTSW 4 48243493 missense probably damaging 0.98
R6248:Erp44 UTSW 4 48219479 nonsense probably null
R6649:Erp44 UTSW 4 48205130 missense probably null 0.01
R6653:Erp44 UTSW 4 48205130 missense probably null 0.01
R6911:Erp44 UTSW 4 48204268 missense probably benign 0.17
R7061:Erp44 UTSW 4 48219375 missense probably benign
R7209:Erp44 UTSW 4 48211704 missense probably benign
R7291:Erp44 UTSW 4 48208792 missense probably damaging 1.00
R7369:Erp44 UTSW 4 48218183 missense probably benign
R7703:Erp44 UTSW 4 48196904 missense probably benign 0.09
R7992:Erp44 UTSW 4 48218136 missense possibly damaging 0.57
R8213:Erp44 UTSW 4 48208783 missense probably benign 0.03
R8332:Erp44 UTSW 4 48243475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAATCAGTGAAATGAGCCAGAATC -3'
(R):5'- TCAGCACTTTCAGAATGGCTG -3'

Sequencing Primer
(F):5'- TGAGCCAGAATCTCAGCTTG -3'
(R):5'- ACCAATTTTTAGGCTGGGGAAG -3'
Posted On2019-11-26