Incidental Mutation 'R7785:Lmtk2'
ID599491
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Namelemur tyrosine kinase 2
SynonymsAATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK
Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R7785 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location144100436-144188204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144174753 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 764 (S764P)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
Predicted Effect probably benign
Transcript: ENSMUST00000041804
AA Change: S764P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: S764P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,613,193 F70L probably benign Het
Adamts5 T C 16: 85,863,004 D800G probably damaging Het
Afm T C 5: 90,550,173 V478A possibly damaging Het
Akap7 T A 10: 25,220,661 K233M probably damaging Het
Atp8b1 A T 18: 64,556,850 S604T probably damaging Het
Bcl2l14 G T 6: 134,432,260 V266F possibly damaging Het
Btnl2 T A 17: 34,361,163 H223Q probably benign Het
Cap2 A G 13: 46,635,748 E255G probably benign Het
Chd6 A T 2: 160,970,175 F1366Y possibly damaging Het
Cryl1 A T 14: 57,275,481 S310T probably benign Het
Cyp2c69 A G 19: 39,851,166 C338R probably damaging Het
Dclre1c C T 2: 3,424,236 Q7* probably null Het
Dhcr7 A G 7: 143,845,472 E193G probably damaging Het
Dnmt1 T C 9: 20,922,049 K652E probably damaging Het
Emilin3 A T 2: 160,910,774 C85* probably null Het
Erp44 G A 4: 48,243,531 P26S probably benign Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fxr1 A G 3: 34,046,254 I121V Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpc5 A G 14: 115,417,220 N484S probably benign Het
Grm8 A G 6: 27,618,637 V402A probably damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Iqgap1 A G 7: 80,738,169 L910P probably damaging Het
Klra2 A T 6: 131,245,290 F13I possibly damaging Het
Ndufs1 T C 1: 63,147,399 D637G probably damaging Het
Nnmt G A 9: 48,592,009 S239F probably benign Het
Pdcd11 A G 19: 47,104,686 I468V probably benign Het
Pkhd1l1 T C 15: 44,543,569 W2401R probably damaging Het
Plec C A 15: 76,205,829 V104F unknown Het
Polq A G 16: 37,027,877 Y282C probably damaging Het
Ppp1r37 A T 7: 19,532,071 V590E probably damaging Het
Prr27 T C 5: 87,843,272 S248P probably benign Het
Ros1 T C 10: 52,162,848 E351G probably damaging Het
Scn11a T C 9: 119,816,556 I111V probably benign Het
Slc35a1 A G 4: 34,675,148 L130S probably damaging Het
Slc39a12 T C 2: 14,420,218 L420P probably damaging Het
Sp140 T A 1: 85,620,098 I182K probably benign Het
Trpv3 C A 11: 73,277,732 H42N probably benign Het
Wdr92 T A 11: 17,229,785 V262E probably damaging Het
Zan A G 5: 137,429,143 S2411P unknown Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144134155 missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144174694 missense probably benign
IGL00848:Lmtk2 APN 5 144176398 missense probably benign
IGL01450:Lmtk2 APN 5 144174702 missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144175935 nonsense probably null
IGL01967:Lmtk2 APN 5 144182779 missense probably benign
IGL01998:Lmtk2 APN 5 144176065 missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144175951 missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144156936 missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144148348 missense probably damaging 1.00
madagascar UTSW 5 144174919 missense probably benign 0.02
A4554:Lmtk2 UTSW 5 144166317 missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144174991 missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144174589 missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144173862 missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144174175 missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144175110 missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144147609 missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144176106 missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144173626 missense probably damaging 1.00
R2352:Lmtk2 UTSW 5 144173911 missense probably benign 0.05
R3870:Lmtk2 UTSW 5 144166427 splice site probably benign
R4011:Lmtk2 UTSW 5 144175879 missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144183226 missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144147664 missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144174781 missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144174934 missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144176447 missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144156900 missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144174838 missense probably benign
R6083:Lmtk2 UTSW 5 144182756 missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144175342 missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144174586 missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144173806 missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144174685 missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144174919 missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144148357 missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144173797 missense probably damaging 1.00
R7286:Lmtk2 UTSW 5 144174360 nonsense probably null
R7390:Lmtk2 UTSW 5 144129443 missense possibly damaging 0.79
R7594:Lmtk2 UTSW 5 144173746 missense probably damaging 1.00
R7660:Lmtk2 UTSW 5 144148340 missense probably damaging 1.00
X0024:Lmtk2 UTSW 5 144174250 missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144182851 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCCTTTTGCACCAAGATCAC -3'
(R):5'- GGGGACTCTGACATCTCTAAAGG -3'

Sequencing Primer
(F):5'- CCACTGAGTGTCCAAGAATTGTCAG -3'
(R):5'- GGACTCTGACATCTCTAAAGGATTTG -3'
Posted On2019-11-26